ID: 1202872648

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177964-177986
Sequence CTCCCTCCGAGCCCGGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 2, 1: 1, 2: 0, 3: 12, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872638_1202872648 4 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122
1202872635_1202872648 23 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122
1202872639_1202872648 3 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122
1202872643_1202872648 -9 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122
1202872634_1202872648 28 Left 1202872634 14_GL000225v1_random:177913-177935 CCACGCCTCAGCGAGAGGACGGA No data
Right 1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG 0: 2
1: 1
2: 0
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872648 Original CRISPR CTCCCTCCGAGCCCGGGCAT GGG Intergenic
900140540 1:1137796-1137818 CTCCCTCCCAGCCCAGCCCTTGG + Intergenic
900610217 1:3541571-3541593 CTCCCGCGGAGCCCAGGCACGGG - Intronic
901022033 1:6260614-6260636 CTCCCTCCGTCCCCCTGCATCGG - Intronic
901630839 1:10647442-10647464 CTCCCTCCGAGCCTCCGTATTGG - Intronic
902578610 1:17394291-17394313 CTCCCCCAGAGCCCTGGTATTGG + Exonic
902686081 1:18078436-18078458 CTCCCTCCGAGACAGGGAACAGG - Intergenic
902757365 1:18557772-18557794 CTCCCTGCCAGCCCAGCCATCGG - Intergenic
904093550 1:27960970-27960992 CTCACTCTGAGCCAGGGCAGTGG - Intronic
905012757 1:34758400-34758422 CTCCCTCCAACCCTGGGCATTGG - Exonic
906320737 1:44813774-44813796 CTCCCTGCGAGTCCCGGCGTTGG - Exonic
907491918 1:54814021-54814043 CTCCTTCCGGGGCTGGGCATGGG + Intronic
917869557 1:179229488-179229510 CTCCCTCCCAGCCCAGGCCCTGG + Exonic
919724688 1:200873973-200873995 CTCATTCCGAGCCCGGGCGCTGG + Exonic
1066055712 10:31678369-31678391 GTCCCTCCCAGCCTGGGCACAGG + Intergenic
1066221216 10:33336863-33336885 CTCCCTCCGAGCCTGGACCGAGG - Intergenic
1070856419 10:79611065-79611087 CTCCTTCCCAGCCTGGGCTTTGG - Intronic
1070924245 10:80207614-80207636 CTCTCTCTGGGCCCGGGGATTGG + Intergenic
1074112774 10:110434096-110434118 CTCTCTCTGAGCCCTGGCACCGG - Intergenic
1075885403 10:125895953-125895975 CTCCCTCCGAGCCCGGGCATGGG - Intronic
1077177244 11:1196485-1196507 CTCCCTCCTGGCCCTGCCATGGG + Intronic
1077253279 11:1570110-1570132 CTCCCTCCGATCCCAGGAACGGG + Intronic
1080722463 11:34863139-34863161 CTCTCTCTGTGCCTGGGCATAGG - Intronic
1081693167 11:45092098-45092120 CTCCCTGACAGCCAGGGCATCGG - Intergenic
1081966459 11:47173111-47173133 CTGCCTCAGAGCCCAGGGATAGG + Intronic
1082783261 11:57302726-57302748 CTCCCTCCGAGCCACCGCCTTGG + Exonic
1084151760 11:67290828-67290850 CTCCCTCCGAGCCTGCTCCTGGG - Intronic
1086080654 11:82900161-82900183 GACCCTCAGAGCCCGGGCAACGG - Intronic
1090031093 11:123207118-123207140 CTCCCTCTGGGCCCAGGGATGGG + Intergenic
1090403851 11:126465783-126465805 CTCCCTCCCTGCCCGGGCTTTGG - Intronic
1090413918 11:126527838-126527860 CTCCCTCCAAGGCCAGGCTTGGG - Intronic
1095163201 12:38941028-38941050 CTTCCTCCAAGCCCTGGCAGTGG + Intergenic
1097063109 12:56300424-56300446 CTCTCCCCGGGCCCGGCCATTGG + Intronic
1102243776 12:111342111-111342133 CTCCCTCCAGGCCCTGGGATGGG - Intronic
1102526996 12:113519618-113519640 CTCCCTCCGAGCAGGGGCGGTGG + Intergenic
1104653745 12:130557494-130557516 CTGCTTCTGAGCCCGGGCAGGGG - Intronic
1110318283 13:74134556-74134578 CGCCCTCCGGCCCCGGGCCTCGG + Intergenic
1114417240 14:22552983-22553005 CCCCCTCCCACCCTGGGCATTGG - Intergenic
1114671159 14:24411813-24411835 CTCCCTCGGAGCCCCGGCACTGG + Intronic
1118900376 14:69980938-69980960 ATCCCTCCCAGCCCGGTCAGTGG - Intronic
1119023937 14:71137773-71137795 CTCCCTCCCAGCTGGGGCCTTGG + Intergenic
1121690964 14:95876863-95876885 CTCCCGCCGAGCCCCGGCGCGGG + Intergenic
1122742560 14:103880681-103880703 CACCCTCCTAGCCCGGGCCAGGG + Intergenic
1122788823 14:104175971-104175993 CTCCCTGCGGGCCCTGGCCTCGG + Exonic
1202872648 14_GL000225v1_random:177964-177986 CTCCCTCCGAGCCCGGGCATGGG + Intergenic
1128551243 15:68599321-68599343 CTCCCTCCCACTCAGGGCATGGG - Intronic
1130994362 15:88895632-88895654 CTCCCTTCGAGCCCAGCCCTTGG - Intergenic
1132659730 16:1055953-1055975 CTACCTGAGAGCCCGGCCATGGG + Intergenic
1133998581 16:10765679-10765701 CTCACACCAAGCCCTGGCATTGG + Intronic
1137871799 16:51956910-51956932 CTCCCTCTCAGCCCTGGCCTTGG + Intergenic
1138540045 16:57682474-57682496 CACCCTCCAAGCCCTGGCCTAGG + Intronic
1138552968 16:57757335-57757357 CCCCCTCCAAGCCCGGGGGTGGG + Intergenic
1140096978 16:71883867-71883889 CTCCCTCCGGGTCCGGGCTGGGG - Intronic
1140194947 16:72848126-72848148 CTCCCTCCGCTCCTGGGGATGGG + Intronic
1141054424 16:80803478-80803500 CGCCCTCCGGGCTCGGGCGTGGG - Intronic
1142156726 16:88535706-88535728 CTCCCTCAGAGCCAGGGCTGAGG + Exonic
1142233807 16:88912070-88912092 CTCCCTCCGGGCCCCGGCCCAGG + Intronic
1142852522 17:2711212-2711234 CCCCCTCTGCGCCCGAGCATGGG - Intronic
1143350166 17:6282286-6282308 CTACCTCCGAACCCTGGCCTGGG + Intergenic
1143382809 17:6507078-6507100 CTCCCTCCAAGCCAGAGCCTGGG - Intronic
1144783315 17:17818540-17818562 CCACCTCCCAGGCCGGGCATAGG + Intronic
1146057092 17:29586958-29586980 CTCCCTCTGCTCCCGGGCATGGG - Intronic
1146433584 17:32822446-32822468 CTCCCGCCGACCACGGGCAGTGG + Intronic
1147884640 17:43676403-43676425 CTCCCTCCCATCCCGGGTTTGGG + Intergenic
1151743821 17:76001117-76001139 TGCCCTCCGAGGCCGGGCATGGG + Intronic
1152390466 17:80001190-80001212 TTCCCTCAGACCCCTGGCATCGG + Intronic
1152435360 17:80273114-80273136 CTCCCTCCGAGGTCCTGCATTGG - Intronic
1159958221 18:74534706-74534728 CTCCATCAGAGTCCGTGCATTGG + Intronic
1160468237 18:79101221-79101243 GTCCCTCTGAGCCCTGGCCTTGG + Intronic
1164590076 19:29501901-29501923 CTCCCTCCGACCCCACTCATGGG - Intergenic
1164856541 19:31529135-31529157 CTACCTCAGAGCTGGGGCATGGG - Intergenic
1166688306 19:44808983-44809005 CTGGCCCCGCGCCCGGGCATCGG + Intergenic
1167285238 19:48595547-48595569 CTCCCTCTGGGCCTTGGCATGGG - Intronic
1168349714 19:55668992-55669014 CTACCCCCAAGCCGGGGCATTGG - Intronic
927424168 2:22962723-22962745 CTCCCTCAGGGACTGGGCATGGG + Intergenic
927932205 2:27052236-27052258 CTCCCTTCCAGCCAGGGCATGGG - Intronic
928218101 2:29379176-29379198 TTCCCTGGGAGCCCAGGCATGGG + Intronic
932921266 2:75917354-75917376 CTCCCTCCATGCACGGGCACTGG + Intergenic
935492842 2:103741481-103741503 CTCCCTCCAAGCATGGGCCTGGG + Intergenic
936041749 2:109155073-109155095 CTCCCTCCGGGCCAGGGCAAGGG + Intronic
939629118 2:144513630-144513652 CTCCCACGGAGCCCGGGAAGAGG - Intronic
939969683 2:148645029-148645051 CTCCTTCCGAGCGCGGGCGCTGG + Exonic
945948909 2:216020498-216020520 CTCCCTCCGAGCACAGCAATTGG - Intronic
948333720 2:237191956-237191978 CTCCCACCGCCCCCGGGGATGGG + Intergenic
1169132578 20:3173656-3173678 CCCCGCCCCAGCCCGGGCATTGG - Intergenic
1171298531 20:24039698-24039720 TTCCCTCAGAGCCCAGGCACTGG + Intergenic
1175561370 20:59933514-59933536 CTCCCTCCGCGCCCCGCCGTGGG + Intronic
1175772026 20:61629994-61630016 CCGCCTCGGAGCCCGGGCAGAGG - Intronic
1175959714 20:62629701-62629723 CTCCATCCGTGCCCGGGGAAAGG + Intergenic
1176101301 20:63365726-63365748 CTCCCTGCCAGCCCTGCCATGGG + Intronic
1178423325 21:32459325-32459347 CTCCCTCCGCCCCTAGGCATTGG + Intronic
1180285446 22:10741512-10741534 CTCCCTCGGAGCCCGGGCATGGG - Intergenic
1180850703 22:19018652-19018674 CTCCCTTCGTGCCCAGGCCTGGG - Intergenic
1181000797 22:19987024-19987046 CTGCCTCCGACCCCGGGCCAGGG + Intronic
1182555251 22:31125576-31125598 CTCCTTCCGAGCCCGGCCTGAGG + Exonic
1182676277 22:32042294-32042316 CTCCCTCTGAACCCTGGCATGGG + Intergenic
1184658544 22:45954601-45954623 CCCCCTGCGTGCCCGTGCATGGG + Intronic
1184677806 22:46053208-46053230 CTCCCCCTGGGCCCTGGCATGGG + Intronic
952382615 3:32816951-32816973 CCCCCTCCGATCCCGAGCCTCGG - Intergenic
955856535 3:63278721-63278743 CTTCCTGCGAGCCCTGGAATTGG + Exonic
959964072 3:112333743-112333765 CTCCCTCCTAGCCCTTGCCTGGG + Intronic
960962905 3:123084507-123084529 CTCCCTCTGAGCCCGGTCCGTGG + Intronic
961447014 3:126985624-126985646 TCCCCTCCTAGCCCCGGCATGGG + Intergenic
963971041 3:151429764-151429786 CACCCTCAGAGCCCGGGCCTGGG - Intronic
967893310 3:194378650-194378672 CTCCCCCAGAGCCCAGTCATGGG + Intergenic
968968894 4:3783393-3783415 CTCCCTCCCAGCCCTGGCACAGG - Intergenic
970585398 4:17510285-17510307 CTCACTCCGATGCCGGGCAGAGG + Intronic
972418903 4:38868262-38868284 CTCCCTTCGTGCCCGGGCTGGGG - Intronic
975197035 4:71537790-71537812 CTCCCACAGAGCCCGAGAATTGG + Intronic
978392673 4:108243424-108243446 CTCACTCTGACCCCAGGCATTGG - Intergenic
987085221 5:14461589-14461611 CTCCCTCCTGGCCCAGGCCTGGG - Intronic
987165616 5:15194827-15194849 ATCCCTCCGAGTCCAGGCAAGGG - Intergenic
997253626 5:132410677-132410699 CTCCCGCCCAGCCCGGGCCCGGG + Intronic
998848670 5:146334528-146334550 CTCCCTCGGACCCTGGGCTTGGG + Intronic
1004933185 6:20481442-20481464 CCCCCTCAGAGCCGGGGCATGGG - Intronic
1008977589 6:57446100-57446122 CTTCCTCAGAGCCAGGGGATTGG + Intronic
1019297346 7:285133-285155 CTCCTTCAGAACCAGGGCATAGG + Intergenic
1019613375 7:1948004-1948026 CTCCCACCGCTCCCGGGCACTGG - Intronic
1021762573 7:23915564-23915586 CTCCCTCCTGTCCTGGGCATTGG + Intergenic
1026014797 7:66664661-66664683 CTCCCCCTGAGCCAGGGCTTTGG + Intronic
1029926937 7:104328532-104328554 CTCCCTCCTGGCCCGGGCTCCGG - Intergenic
1036211063 8:6841714-6841736 CTCCCTCTGTGCCAGGGCCTGGG - Intergenic
1038644634 8:29351512-29351534 CTCACTCCGATCCTGGGCTTCGG - Intergenic
1039576630 8:38628879-38628901 CTCCCTCAGTGCCCTGTCATGGG - Intergenic
1041552536 8:59118470-59118492 CTCCCTCCCTCCCCGGGCAGTGG - Intronic
1043404202 8:79914292-79914314 CTCCCACCGAGCTCAGTCATTGG - Intergenic
1045063449 8:98426906-98426928 CGCCTTCCGAGCCCGGGCGGCGG + Intronic
1046521370 8:115330698-115330720 CTCCCTGCGAGGCAGGGCTTGGG - Intergenic
1049279628 8:141737655-141737677 CTCCCTCTCTGCCTGGGCATTGG + Intergenic
1049344385 8:142130588-142130610 CTCCCTCTTAGCCCTGGGATGGG - Intergenic
1056475096 9:86945884-86945906 CACCCACCGCGCCCGGGCAGCGG - Exonic
1060822894 9:126671785-126671807 CTCCCTCCAGGCCAGGGCAGCGG + Intronic
1062431027 9:136526950-136526972 CCCACTCCCAGCCTGGGCATCGG + Intronic
1187341683 X:18426126-18426148 CTCCCTCCGAACTCGGGCAGGGG - Intronic
1190526350 X:51332801-51332823 CTGCCCCCGAGCCCGGGGAGCGG - Intronic
1190775717 X:53550889-53550911 CTCCCTCTGTACCCGGGCTTCGG + Exonic
1192215225 X:69153412-69153434 CTCCCTCCCAGGCTGGGCACTGG - Intergenic
1200400686 X:156018784-156018806 GACCCTCCGAGCCCAGGCGTGGG - Intergenic