ID: 1202872652

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177969-177991
Sequence TCCGAGCCCGGGCATGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 2, 1: 1, 2: 0, 3: 12, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872639_1202872652 8 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG 0: 2
1: 1
2: 0
3: 12
4: 216
1202872638_1202872652 9 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG 0: 2
1: 1
2: 0
3: 12
4: 216
1202872643_1202872652 -4 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG 0: 2
1: 1
2: 0
3: 12
4: 216
1202872635_1202872652 28 Left 1202872635 14_GL000225v1_random:177918-177940 CCTCAGCGAGAGGACGGAGCCCT No data
Right 1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG 0: 2
1: 1
2: 0
3: 12
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872652 Original CRISPR TCCGAGCCCGGGCATGGGCC GGG Intergenic
902360719 1:15941360-15941382 TCAGAGCCAGGGCAGTGGCCTGG + Intergenic
902606571 1:17572588-17572610 TCAGAGCCAGGGCAGGGGCTAGG - Intronic
903233975 1:21937577-21937599 CCCGGGCCCGGGCATGGGATGGG + Intergenic
903848886 1:26294611-26294633 ACCGAGCCCTCGCATGGGCTGGG - Intronic
904034292 1:27550773-27550795 ACTGAGACCGGGCCTGGGCCTGG + Exonic
905478872 1:38247685-38247707 ACCCAGCCCTGGCATTGGCCTGG + Intergenic
905512786 1:38535931-38535953 TCAGAGCCCAGCCATGTGCCTGG - Intergenic
905943407 1:41882398-41882420 TCCCAGCCCCTGCATGGGACAGG + Intronic
914477525 1:148036290-148036312 TCCGTTCCTGGGCATAGGCCAGG + Intergenic
919724690 1:200873978-200874000 TCCGAGCCCGGGCGCTGGACGGG + Exonic
920397779 1:205659425-205659447 TCCGGGCCGGGGCATCTGCCTGG - Exonic
921023965 1:211260231-211260253 TAGGAGTCCGGGCATGGGGCCGG + Intronic
921930202 1:220748572-220748594 TCCCAGCCCGGCCCTGGCCCAGG + Exonic
922192013 1:223327710-223327732 TCAGGGCCCCGGCATGGCCCAGG + Intronic
922219878 1:223550383-223550405 TCCGGGTCCAGGGATGGGCCAGG - Intronic
924739791 1:246788309-246788331 TCCGAGCCAGGGTCTGGGGCTGG + Intergenic
1065215174 10:23440566-23440588 CCCAAGACGGGGCATGGGCCGGG + Exonic
1065433419 10:25682590-25682612 TCAGAGCCAGGGCAGAGGCCAGG - Intergenic
1067037246 10:42929843-42929865 CCCCACCCAGGGCATGGGCCAGG + Intergenic
1067450936 10:46381455-46381477 TCAGAGCCCGGGCCGGGGGCTGG + Intronic
1067478005 10:46578937-46578959 GCCGGGCCTGGGCCTGGGCCAGG + Intronic
1067586308 10:47478296-47478318 TCAGAGCCCGGGCCGGGGGCTGG - Intronic
1067616734 10:47762850-47762872 GCCGGGCCTGGGCCTGGGCCAGG - Intergenic
1071341773 10:84655639-84655661 TCCCAGACAGGGCAGGGGCCGGG + Intergenic
1071597415 10:86938416-86938438 TCTGTGCCCGTGCATGGGCCTGG - Intronic
1072253770 10:93601361-93601383 CCGGAGCCCGGGCACGGGCAGGG + Exonic
1073445113 10:103575763-103575785 TACCAGCCTGGGCTTGGGCCAGG - Intronic
1074537225 10:114337200-114337222 GCAGAGCCAGGGCTTGGGCCTGG - Intronic
1075885399 10:125895948-125895970 TCCGAGCCCGGGCATGGGCCGGG - Intronic
1076250325 10:128979652-128979674 TCCCAGCCCTGGCATGGTCCAGG + Intergenic
1076395831 10:130136748-130136770 TCGGAGCCAGGGCTGGGGCCGGG - Intronic
1076749995 10:132537751-132537773 GCCGAGCCCGGGGCGGGGCCTGG - Intergenic
1076785484 10:132747603-132747625 TCCGAGCCCCGGCCAGCGCCCGG + Intronic
1077229744 11:1453461-1453483 TCCAGGCCCTGGCATGGGGCTGG + Intronic
1077373633 11:2195169-2195191 TCCCTGCCCGGGGAGGGGCCTGG + Intergenic
1077375121 11:2202162-2202184 TCTGAGCCCTGGCATGAGCTGGG - Intergenic
1078246127 11:9574219-9574241 TCCGCGCCCGGGCAGGCGCCGGG - Exonic
1080590923 11:33722596-33722618 TCAGAGCTGGGGCATGGCCCAGG - Intronic
1081020158 11:37936491-37936513 TCCGAGCCCAGGAATGGCCCTGG + Intergenic
1083144939 11:60751096-60751118 ACAGAGCCAGGGCATGGGCCAGG + Intergenic
1083656792 11:64233959-64233981 ACGAAGCCCGGGCACGGGCCAGG + Exonic
1083859310 11:65411516-65411538 GCACAGCCCGGGCATGGCCCCGG - Exonic
1084891691 11:72239936-72239958 TCCGGGCCGGGACCTGGGCCGGG - Exonic
1087156810 11:94912981-94913003 GCCGAGCCAGCGCCTGGGCCTGG + Intergenic
1092318055 12:7440301-7440323 GCCGCGCCCGGGCAGGGACCTGG + Intronic
1096143915 12:49264959-49264981 TTCGAGCCCTGGCCTGCGCCCGG - Exonic
1096496999 12:52044362-52044384 TGGGAGGCCGGGCAAGGGCCCGG - Intronic
1096870391 12:54588777-54588799 GCCGAGTCCGGGCGTGGCCCGGG + Intergenic
1098931148 12:76415536-76415558 TCAGAGGCTGGGCATGGGCATGG - Intronic
1104653471 12:130555928-130555950 TCCGTGCCTGGCGATGGGCCTGG - Intronic
1104697153 12:130872192-130872214 TCGGAGCCGGGGCCAGGGCCGGG + Intronic
1105859430 13:24395618-24395640 TCCCAGCCTGAGCCTGGGCCTGG - Intergenic
1108413274 13:50172023-50172045 GCCGAGCCAGCGCCTGGGCCTGG + Intronic
1112051089 13:95644350-95644372 GCCGAGACCGGGGATGCGCCAGG - Intronic
1114484661 14:23055644-23055666 CCCCAGCCCGGGCCTGGGCAGGG - Exonic
1115753787 14:36514692-36514714 TCCCCGCCCGGGCTTGGGCTAGG + Intergenic
1117457483 14:55912490-55912512 TAGGAGCCCGGACATGGGCATGG + Intergenic
1118323880 14:64768755-64768777 TACCAGCCCGGGCATGAGGCTGG + Intronic
1119286395 14:73458363-73458385 TCGGGGCCCGGGCCGGGGCCGGG - Intronic
1120889157 14:89476368-89476390 TCCGAGCAGGGGCATCTGCCGGG - Intronic
1122901839 14:104785260-104785282 CCCGGGCCCGGGCAGAGGCCTGG - Intronic
1122975107 14:105167814-105167836 ACCGAGCGCGGGCGCGGGCCCGG - Exonic
1202872652 14_GL000225v1_random:177969-177991 TCCGAGCCCGGGCATGGGCCGGG + Intergenic
1123919077 15:25057881-25057903 TCCGAGCCAGGGCCAGGGCCAGG - Intergenic
1124019700 15:25909270-25909292 TCTGAGACTGGGGATGGGCCAGG + Intergenic
1127256289 15:57296611-57296633 TCCCACCCCTGGCTTGGGCCTGG + Intronic
1128758830 15:70201091-70201113 GCCGAGCCTGGGCCTGGGCGAGG + Intergenic
1129355420 15:74987617-74987639 TCCCAGCCTGGGCCTGGCCCTGG - Intronic
1129890001 15:79065633-79065655 GCCCAGCCTGGGCCTGGGCCTGG + Intronic
1130531205 15:84748754-84748776 TCCGAGCCCGAGCCGGGGCCCGG + Intronic
1130543811 15:84840486-84840508 TCCTGGCCTGGGCCTGGGCCAGG - Exonic
1130908702 15:88256840-88256862 TCCCAGCCCGGGCGGGGGGCGGG - Intergenic
1131238519 15:90717679-90717701 TCGGAGGCCGAGCATGGGCTAGG + Intronic
1132527870 16:426322-426344 TCGGAGCGCGGCCCTGGGCCCGG - Exonic
1132853684 16:2035603-2035625 TCCCAGCCAGGGGGTGGGCCAGG - Intronic
1133040941 16:3059430-3059452 CCCGAGCCCGGGGAGGGGCGGGG + Exonic
1133223573 16:4329344-4329366 TCCCAGGCCATGCATGGGCCAGG - Intronic
1133272122 16:4615323-4615345 TCCGTGCCAGAGCAGGGGCCGGG - Intergenic
1135112408 16:19700480-19700502 CCTGAGCCTGGGGATGGGCCCGG - Exonic
1136281886 16:29218171-29218193 TCCCAGCCCGGGCAGGGGAGGGG - Intergenic
1138228921 16:55323970-55323992 TCCAAGCCCTGGCCTGGCCCAGG - Exonic
1138550192 16:57743657-57743679 TGTGAGCCAGGGCAGGGGCCCGG - Intronic
1139359924 16:66391201-66391223 TCCAAGCCCCAGCATGGGGCTGG - Intronic
1141620878 16:85235965-85235987 TCCGGCGCCGGGCCTGGGCCTGG + Intergenic
1141620881 16:85235971-85235993 GCCGGGCCTGGGCCTGGGCCTGG + Intergenic
1142086260 16:88184087-88184109 TCCCAGCCCGGGCAGGGGAGGGG - Intergenic
1142289007 16:89184183-89184205 TCCAAGCCTGAGCCTGGGCCAGG - Intronic
1142593692 17:1019374-1019396 TCTGAGGCCAGGCCTGGGCCAGG + Intronic
1143665384 17:8355513-8355535 GCCGAGCCCAGCCATGGGGCAGG + Intergenic
1144787588 17:17840475-17840497 GCCGAGGTCGGGCAGGGGCCGGG - Intergenic
1145049511 17:19648585-19648607 GCCGAGCGCGGCCACGGGCCAGG - Intronic
1145064510 17:19753005-19753027 TGGGAGCCAGGGCCTGGGCCTGG - Intergenic
1146256345 17:31393097-31393119 CCCGCACCTGGGCATGGGCCGGG + Intronic
1147193869 17:38752342-38752364 TCCGAGCCTAGGCAAGTGCCTGG + Intergenic
1148689712 17:49520204-49520226 CTGGAGCCCGGGCATGGCCCAGG - Intergenic
1151772861 17:76176790-76176812 TCCGCGCCCAGGCCTGGCCCTGG - Intronic
1152103027 17:78314016-78314038 TGCGAGCCCGTGCCCGGGCCGGG + Intergenic
1152231844 17:79117756-79117778 CCCCTGCCCTGGCATGGGCCTGG - Intronic
1152641375 17:81450643-81450665 TCAGAGACCGGGCAGGGGCAGGG + Intronic
1154287482 18:13073756-13073778 ACCAAGCCCGTGCATGGGGCTGG + Intronic
1159798077 18:72867701-72867723 CCCGAGCCGGGGCCGGGGCCGGG + Exonic
1160794948 19:940954-940976 TCCTGGCACGGGCACGGGCCGGG - Intronic
1161170148 19:2808450-2808472 TGCGGGCCCGGGCAGGGGCAGGG + Intronic
1161358637 19:3833909-3833931 TCCGGGCCAGGGCCTGGTCCTGG - Intronic
1162366413 19:10252267-10252289 TCCGGGCCGGGGCGCGGGCCTGG + Exonic
1163218438 19:15897500-15897522 TCCAGGCCAGGACATGGGCCAGG + Exonic
1163478220 19:17539423-17539445 GCCGCGCCCGCGCCTGGGCCTGG + Exonic
1165311383 19:35030963-35030985 GCGGGGCCCGGGGATGGGCCGGG - Intronic
1166394181 19:42426719-42426741 GCCCAGCCAGGGCCTGGGCCAGG - Exonic
1166643075 19:44511300-44511322 TCTGGGCCAGGGCAAGGGCCTGG - Intronic
1166980784 19:46630957-46630979 TCTGACCCCCAGCATGGGCCTGG + Intergenic
1167071789 19:47226335-47226357 CCCGAGCCAGGGCCAGGGCCAGG - Intronic
1168435548 19:56314526-56314548 ACCGAGCCCGGGGATGGGACTGG - Intronic
926092187 2:10058269-10058291 TCGGAGCTCGGGCCTGGGCTGGG + Exonic
926251439 2:11157383-11157405 TCCAAGCCAGGGCCAGGGCCAGG + Intronic
926354048 2:12023494-12023516 GCCGAGCCAGCGCCTGGGCCTGG + Intergenic
926751828 2:16204289-16204311 TCGGAGCCCTGGCATGGAGCTGG + Intergenic
927520004 2:23692961-23692983 TCAGAGCCTGGGCCTGGGCTGGG - Intronic
927848443 2:26484309-26484331 TCCGAGGCAGGGCAGGGGCAGGG - Intronic
928383292 2:30839704-30839726 TAAGAGCCCGGGCTGGGGCCAGG - Intergenic
931249934 2:60521356-60521378 CCCGGGCCTGGGCCTGGGCCTGG + Intronic
937207171 2:120244283-120244305 CCTGAGCCTGGGCCTGGGCCTGG - Intronic
937235098 2:120426502-120426524 TCCAAGCCAGGACAGGGGCCGGG - Intergenic
938054977 2:128208131-128208153 TCCGAGCCCGGGGCTGTGGCCGG - Intergenic
942457717 2:176149383-176149405 TTCAAGCCTGGGCCTGGGCCTGG - Intergenic
948738360 2:240025560-240025582 TCAGAACCCAGGCAGGGGCCGGG - Intergenic
948981719 2:241498046-241498068 CCCGAGCCCCAGCATGTGCCGGG - Intronic
1173166008 20:40687838-40687860 TCCGGGCCGGGGCAAGGGCGGGG + Exonic
1173488482 20:43458578-43458600 TCCCAGCCCGGGCAGGCGCGAGG + Intronic
1173994209 20:47325327-47325349 TCCGAGCCAGGCCATGTACCTGG - Intronic
1175942864 20:62546000-62546022 TCCGAGCCTGGGCCTGGGTGTGG - Intergenic
1176251273 20:64121532-64121554 TCAGAGCCTGGGCATGGGGGTGG - Intergenic
1176303838 21:5113366-5113388 TCAGAGCCCGGGCCTGGCCGGGG + Intergenic
1178019982 21:28396641-28396663 CACAAGCCTGGGCATGGGCCTGG - Intergenic
1178350826 21:31872600-31872622 TGCGAGCCCGGGCAGACGCCTGG + Intergenic
1179853192 21:44148584-44148606 TCAGAGCCCGGGCCTGGCCGGGG - Intergenic
1180285442 22:10741507-10741529 TCGGAGCCCGGGCATGGGCCGGG - Intergenic
1180949299 22:19714166-19714188 TCCGAGGACCGGCATGGACCCGG + Intergenic
1182684286 22:32109320-32109342 TCTGAGCCCAGGCGTGGCCCTGG - Intronic
1183650666 22:39151817-39151839 TCAGAGCCCTGGCCTGGGCTAGG + Intronic
1183744830 22:39686240-39686262 TCCGGGCCAGGCCGTGGGCCAGG - Exonic
1183883441 22:40856585-40856607 GCCGAGCCAGCGCCTGGGCCTGG - Exonic
1184522099 22:45000803-45000825 TCAGAGCCCGGGCAGGGGGGTGG + Intronic
1184745330 22:46452640-46452662 TCCAAGCCAAGGCGTGGGCCAGG + Intronic
1185417455 22:50718048-50718070 ACAGAGCCAGGGCATGGGGCAGG - Intergenic
951024506 3:17815460-17815482 TCCAAGGACGGGCATGGGGCTGG + Intronic
952867306 3:37862345-37862367 GCCGGGCGCCGGCATGGGCCTGG + Intronic
953405449 3:42657519-42657541 TCACAGCCAGGGCTTGGGCCAGG - Intronic
954626209 3:52023373-52023395 TCAGAGCCCTGGCCAGGGCCTGG - Intergenic
955603152 3:60669765-60669787 TCTGAGCCCCAGCAGGGGCCTGG - Intronic
961346633 3:126267624-126267646 TCCGAGCCGGGGACTGCGCCAGG - Intergenic
961792953 3:129389727-129389749 TCCAAGCCAGAGCATGGGCCTGG - Intergenic
961816165 3:129551546-129551568 TCTGAGCCCCAGCATTGGCCAGG - Intergenic
962316246 3:134361272-134361294 CCCGAGGCTGGACATGGGCCAGG + Intronic
963530636 3:146469705-146469727 TCTGAGCCCGCGCAGGGACCAGG - Intronic
967147850 3:186620986-186621008 TCCAAGCCTGGGCATGGGTGGGG + Exonic
968120196 3:196120536-196120558 TCCCAGCCCAGGCAGGCGCCCGG + Intergenic
968232005 3:197009850-197009872 TGAGAGCCCGGGCAAGTGCCTGG + Intronic
968442018 4:628973-628995 TCCATGCCCAGGCCTGGGCCAGG - Intronic
968801431 4:2745722-2745744 TCCGGGCTCTGGCCTGGGCCAGG - Intronic
968811458 4:2801333-2801355 TCGGGGCCCGGGCAGGGGACAGG - Intronic
969621658 4:8281769-8281791 TCTGAGCCCGGGAAGGGTCCAGG + Intronic
972312131 4:37891310-37891332 TCAGAGCCCGGGGCCGGGCCGGG - Exonic
975118481 4:70704884-70704906 TTCGCGCCCGGGCCTGGGCGGGG - Intronic
985484044 5:139121-139143 TCCCAGCCTGGGCAAGGGGCCGG - Intergenic
985652028 5:1111806-1111828 CCCGAGCGCGGGTCTGGGCCCGG - Intronic
987374226 5:17218588-17218610 CCCGGGCCCGGGCCGGGGCCGGG - Intronic
988900064 5:35722284-35722306 TCCCAGCCCTGGCATGGGGCAGG + Intronic
992542463 5:77778467-77778489 CCAGAGCCTGGGAATGGGCCTGG - Intronic
994245474 5:97471457-97471479 GCTGAGCCTGGGCATTGGCCAGG - Intergenic
997428265 5:133819251-133819273 TCCCAGCCTGGGCAAGGGACAGG + Intergenic
998166715 5:139848469-139848491 GCCGGGCCCGGGCCCGGGCCCGG + Exonic
998166716 5:139848470-139848492 CCCGGGCCCGGGCCCGGGCCCGG - Exonic
998839023 5:146233614-146233636 CCTGGGCCCGGGCCTGGGCCTGG - Exonic
998839035 5:146233638-146233660 CCTGGGCCCGGGCCTGGGCCTGG - Exonic
1001489441 5:172145241-172145263 TCAGGGCAGGGGCATGGGCCTGG - Intronic
1001822390 5:174720534-174720556 ACCGAGCCCGGGTTTGAGCCGGG - Intergenic
1003173934 6:3740961-3740983 TCGCATCCCTGGCATGGGCCAGG - Intronic
1006472784 6:34237692-34237714 CCCGAGCCCGAGCCCGGGCCCGG + Intronic
1007479893 6:42142760-42142782 TCCCAGGCTGGGCGTGGGCCGGG - Intergenic
1019351213 7:554881-554903 TCCGAGCCATGAAATGGGCCTGG - Intronic
1019351695 7:557043-557065 TCCCACCCCCGGCCTGGGCCGGG + Intronic
1019408951 7:898365-898387 CTCCAGCCCGGGCAGGGGCCGGG + Exonic
1024215051 7:47241462-47241484 TCCGATGCCTGCCATGGGCCAGG + Intergenic
1028831317 7:95329270-95329292 TCGTAGCCCAGGCATTGGCCAGG + Intergenic
1029448797 7:100629224-100629246 TCAGGGCCAGGGCCTGGGCCTGG - Intronic
1031689161 7:124766179-124766201 CCCGAGCCCGGGCTAGGGGCGGG + Intergenic
1032094206 7:128929534-128929556 TCCCAGCCCTGCCAGGGGCCAGG + Intergenic
1032130725 7:129225257-129225279 CCCGAGCCCGGGCCGGGGACCGG - Exonic
1032588499 7:133170558-133170580 GCCGAGCCAGCGCCTGGGCCTGG - Intergenic
1033217284 7:139502388-139502410 ACCGAGCCAGCGCCTGGGCCTGG + Intergenic
1035666599 8:1384750-1384772 TCAGGGGCCGGGCATAGGCCGGG - Intergenic
1035666665 8:1385000-1385022 TCAGGGGCCGGGCATAGGCCGGG - Intergenic
1035850485 8:2914834-2914856 TCCCAGCCGGGGCATCAGCCAGG + Intergenic
1037818901 8:22126208-22126230 TCCCAGCCAGGGCAGAGGCCTGG + Intronic
1038778698 8:30552896-30552918 TCCGAGCCCAGGCAGGGACAAGG - Intronic
1039864738 8:41490780-41490802 TCAGAGCCCCGGCCTGGACCCGG - Exonic
1045879031 8:107015503-107015525 TCCAAGCCCTGGGATGGGCTGGG - Intergenic
1049343148 8:142124472-142124494 ACCGAGGCCTGGCATGAGCCTGG - Intergenic
1049361698 8:142215111-142215133 TGCGGGCCCTGGCCTGGGCCCGG - Intronic
1049377168 8:142294810-142294832 TGCGAGCCCTGGCATGGGCGAGG - Intronic
1049399177 8:142417256-142417278 TCCAAGGCCGGGCAGGGGACAGG - Intergenic
1049472525 8:142782823-142782845 TCCGAGGCTGGGGTTGGGCCTGG - Intergenic
1049529607 8:143147818-143147840 TCCGAGCACCGCCATGGGCCAGG + Intergenic
1049668521 8:143859345-143859367 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049668937 8:143860947-143860969 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049669352 8:143862549-143862571 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049669764 8:143864142-143864164 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049670179 8:143865750-143865772 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1056834607 9:89944450-89944472 TCCCACTCCTGGCATGGGCCTGG - Intergenic
1058790173 9:108436451-108436473 TCCGGGCCCGGGCAGGGCTCAGG - Intergenic
1059305358 9:113349613-113349635 TCCGGGTCCGGGCCCGGGCCGGG + Exonic
1059340269 9:113594100-113594122 TCCCAGCCCCGGCTTGTGCCTGG + Intronic
1060481516 9:124018966-124018988 ACCGAGCCCCCGCCTGGGCCTGG - Intronic
1060994287 9:127867496-127867518 TCCAGGCCCCGGCAAGGGCCAGG + Exonic
1061147731 9:128809455-128809477 TCCAAGCCCGGCTTTGGGCCAGG + Exonic
1061208811 9:129178974-129178996 TCCGAGGCCAGGCATGACCCAGG + Intergenic
1061543345 9:131290015-131290037 TGCGGTCCCGGGCACGGGCCCGG - Exonic
1061901135 9:133672651-133672673 TCAGAGCCCGGTGCTGGGCCGGG - Intronic
1062042079 9:134408796-134408818 TCTGAGCCCAGGCAGGGGTCTGG + Intronic
1062043739 9:134415749-134415771 TCCGAGCTCAGACATGGACCTGG - Intronic
1062130255 9:134888685-134888707 TCCGAGGCCTGGGATGAGCCAGG + Intergenic
1062570154 9:137181233-137181255 TCTGTGCCAGGGCAGGGGCCAGG + Intronic
1062696189 9:137877601-137877623 TCCCACCCCGGGGCTGGGCCGGG - Intergenic
1187341679 X:18426121-18426143 TCCGAACTCGGGCAGGGGGCTGG - Intronic
1191846389 X:65550722-65550744 GCACAGCCCGGGCATGGCCCCGG + Intergenic
1196377077 X:115045103-115045125 TCTGAGCCCTGACATGGCCCTGG - Intergenic
1201794174 Y:17876792-17876814 TCCTAGCCCTGGCATGGGAAAGG - Intergenic
1201807380 Y:18029193-18029215 TCCTAGCCCTGGCATGGGAAAGG + Intergenic
1202355556 Y:24044611-24044633 TCCTAGCCCTGGCATGGGAAAGG - Intergenic
1202515222 Y:25625498-25625520 TCCTAGCCCTGGCATGGGAAAGG + Intergenic