ID: 1202872653

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177970-177992
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872653_1202872667 16 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872653_1202872664 8 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872664 14_GL000225v1_random:178001-178023 GTCCCTGGAGCCCCCCTGACGGG No data
1202872653_1202872660 -7 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872653_1202872663 7 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872653 Original CRISPR GCCCGGCCCATGCCCGGGCT CGG (reversed) Intergenic
No off target data available for this crispr