ID: 1202872654

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177974-177996
Sequence GCCCGGGCATGGGCCGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 3, 1: 0, 2: 5, 3: 88, 4: 819}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872644_1202872654 -6 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819
1202872643_1202872654 1 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819
1202872639_1202872654 13 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819
1202872638_1202872654 14 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG 0: 3
1: 0
2: 5
3: 88
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872654 Original CRISPR GCCCGGGCATGGGCCGGGCC TGG Intergenic
900119070 1:1040969-1040991 GCGGGGGCAGGGGCGGGGCCCGG + Intronic
900172134 1:1274220-1274242 GCCCGGGCATGGAGCGTCCCGGG + Intergenic
900342281 1:2194798-2194820 GCCGGGGCGGGGGCGGGGCCTGG - Intronic
900346879 1:2214368-2214390 GGCAGGGGATGGGCAGGGCCTGG + Intergenic
900389701 1:2428628-2428650 GCCGGCGCAAGGGCCGGGCGTGG - Intronic
900418563 1:2546015-2546037 GCCCGGGCAGGTGCCTGGGCTGG + Intergenic
900497611 1:2983078-2983100 GCCAGGGCCAGGGCCGGGGCTGG + Intergenic
900527019 1:3134376-3134398 GCACGGGCATGGGCTGGGCGGGG + Intronic
900528585 1:3141554-3141576 GTCCGGGCAGAGGCCTGGCCGGG - Intronic
900626631 1:3611543-3611565 GTCCGGGCTGGGGGCGGGCCGGG - Intergenic
900633249 1:3649792-3649814 GCCCGGACAGGTGCGGGGCCCGG - Intronic
901040513 1:6360365-6360387 GCCCGGGCCTGGGCCCCGGCAGG - Intronic
901109835 1:6785643-6785665 TCCCGGGCATCGGCGGCGCCGGG + Intronic
901297268 1:8170229-8170251 GCCAGGGCATGGCCAGGGCAGGG + Intergenic
901597871 1:10399325-10399347 GCGCAGGCATGGGGCGGGGCGGG + Intronic
901628642 1:10637689-10637711 GCCCGGGCCAGGGCCTGACCTGG - Exonic
901635354 1:10667883-10667905 GCCCGGGCAGGGACTGAGCCAGG - Intronic
901639939 1:10688068-10688090 CCCCGGGCCTGGTACGGGCCGGG - Intronic
901766304 1:11502157-11502179 GCCTGGGCCTGGGCCTGGCCTGG - Intronic
902079473 1:13811479-13811501 CCCTGGACAGGGGCCGGGCCTGG + Intronic
902396530 1:16135000-16135022 CCCTGGGCATGGACCAGGCCAGG - Intronic
902448450 1:16482473-16482495 GCCAGGGCCTGGGCCTGGCCTGG - Intergenic
902561049 1:17277715-17277737 GCCTGGGCATGGGGAGGGCTGGG + Intronic
902896951 1:19485595-19485617 GGGCGGGCCCGGGCCGGGCCGGG - Intergenic
903184672 1:21622425-21622447 GCCCCGGCGGGGGCCGGGCCGGG - Intronic
903215822 1:21842813-21842835 ACCTGGGCATGGGCCTGCCCGGG + Exonic
903216546 1:21846491-21846513 ACCTGGGCATGGGCCTGCCCGGG + Exonic
903251053 1:22053142-22053164 GCGGGCGCTTGGGCCGGGCCGGG + Intronic
903283360 1:22262767-22262789 GCCCTGGGTGGGGCCGGGCCTGG + Intergenic
903324793 1:22563628-22563650 GCCCGGCCATGGCCCCCGCCCGG + Exonic
903777100 1:25800223-25800245 CCGCAGCCATGGGCCGGGCCCGG + Exonic
904034294 1:27550778-27550800 GACCGGGCCTGGGCCTGGCAGGG + Exonic
904080070 1:27866685-27866707 AGCTGGGCATGGGCCGGGCATGG + Intergenic
904171052 1:28592444-28592466 CCCCGGGCAGGGGCGGGGTCGGG + Intronic
904253020 1:29237910-29237932 GTCCGGGCGCGGGCAGGGCCTGG + Intronic
904300411 1:29550142-29550164 TGCAGGGCATGGGCTGGGCCTGG + Intergenic
904457809 1:30657916-30657938 TGCAGGGCATGGGCTGGGCCTGG - Intergenic
904500114 1:30908510-30908532 GCCGGGGCCGCGGCCGGGCCCGG - Exonic
904563346 1:31413178-31413200 GGCCGGGGAGGGGCCAGGCCCGG + Intronic
904782968 1:32964471-32964493 GCCGCGGCAGGGGCCGGGGCGGG + Exonic
905067023 1:35192607-35192629 GCCCCGCCAGGGTCCGGGCCAGG - Exonic
905462205 1:38129213-38129235 TCCTGGGCCTTGGCCGGGCCTGG - Intergenic
905584333 1:39105282-39105304 GGCGGGGAACGGGCCGGGCCTGG + Intronic
905631442 1:39521283-39521305 GCCGGGGCCTGGGCAGGTCCAGG - Intronic
905666312 1:39764888-39764910 GCCGGGGCCTGGGCAGGTCCAGG + Intronic
905789825 1:40784044-40784066 GCCCGGGCACGGTCCGGGGCGGG - Exonic
906062535 1:42958185-42958207 GCCGGGGCCGGGGCCGGGCCGGG + Intronic
906078744 1:43069938-43069960 GCCTGGCTCTGGGCCGGGCCTGG - Intergenic
908132081 1:61083458-61083480 GTCCGGGCCGGGGCCGGGACGGG - Intronic
908209563 1:61886527-61886549 TCCTGGTCATGGGCTGGGCCTGG + Intronic
910550278 1:88467166-88467188 GCCCGGGGCCGGGCCGGGCCGGG - Intergenic
911176161 1:94820355-94820377 GCCGGGGCCGGGGCCGGGGCTGG - Exonic
912381442 1:109249990-109250012 GCCCGGGCATGAGGCGCGGCGGG + Intergenic
912829541 1:112939886-112939908 GCCAGGGGATGGGCAGGGGCGGG - Intronic
913213190 1:116598737-116598759 GCCGAGGCATGGGCTGGGCGAGG + Intronic
913957382 1:143318385-143318407 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
914051696 1:144143749-144143771 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
914127501 1:144822792-144822814 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
914758455 1:150579759-150579781 GGCCGGGCCGGGGCGGGGCCGGG + Intergenic
914758465 1:150579776-150579798 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
914847082 1:151289277-151289299 GCCCGGGGGAGGGCCGGGCTGGG + Intronic
915246236 1:154558291-154558313 GCCGGGGCGGGGGCCGCGCCCGG - Exonic
915303100 1:154962455-154962477 CCCCGGGCCTAGGCTGGGCCGGG + Exonic
915338374 1:155161719-155161741 AGCCAGGCATGGGCCGGGCGTGG - Intergenic
915362671 1:155295353-155295375 GCCCAGGCGTGGGCAGGGGCGGG - Intronic
915512991 1:156396896-156396918 AGCCAGGCATGGGCCGGGCGCGG - Intergenic
917291571 1:173477169-173477191 GGGCGGGGCTGGGCCGGGCCGGG - Intergenic
917629601 1:176879113-176879135 GCTGGGGCATGGGCCTGACCCGG + Intronic
917742043 1:177970158-177970180 GCCTGAGCATGGGCTGAGCCAGG + Intronic
918015981 1:180632522-180632544 GCCCGGGCCGGGGCCGGGGCCGG + Intronic
918189914 1:182164071-182164093 GCCCTGGCATCGGCAGGGACTGG - Intergenic
918497416 1:185156534-185156556 GCCAGGGCAGGGGCTGGGGCTGG + Exonic
919914307 1:202130337-202130359 GCCCAGGGATGGGCAGGGGCAGG + Exonic
919915601 1:202137144-202137166 GGCAGGGCATGGGCTGGGCGCGG - Intronic
920805611 1:209231558-209231580 GCGCAGGCAGGGGCCGGGCCGGG - Intergenic
922416556 1:225427852-225427874 GCCGGCGCAGCGGCCGGGCCGGG - Intronic
923126683 1:231039987-231040009 GCCCGGGCGGCGGCGGGGCCCGG - Exonic
923448374 1:234093697-234093719 GCCCCGGCAGGGCCCGGGGCTGG - Intronic
923463873 1:234231440-234231462 GCCTGGGCCTCCGCCGGGCCCGG - Exonic
923631154 1:235650100-235650122 GCCCGGGCTGGGGCGGGGGCGGG - Intronic
924775197 1:247111435-247111457 GCCCGGGCGGGCGCAGGGCCGGG + Exonic
1062843682 10:689390-689412 GGCGGGGCGGGGGCCGGGCCCGG - Intronic
1062873882 10:930964-930986 GGCAGGGCCTGGGCGGGGCCGGG - Intronic
1062874011 10:931281-931303 GCCGGGGCCGGGGCCGGGGCAGG - Intronic
1062874015 10:931287-931309 GCCTGGGCCGGGGCCGGGGCCGG - Intronic
1062874019 10:931293-931315 GGCCGGGCCTGGGCCGGGGCCGG - Intronic
1064007718 10:11711857-11711879 TCCCAGACATGGGCCGGGCCTGG + Intergenic
1064144857 10:12819418-12819440 GGCAGGGCAGGGGCCTGGCCTGG + Intronic
1064418005 10:15167912-15167934 TCCCCAGCAGGGGCCGGGCCCGG + Intronic
1065024493 10:21527190-21527212 GGCGGGGCGTGCGCCGGGCCGGG + Intergenic
1065599067 10:27350155-27350177 GCCTGGGCAGGAGCAGGGCCAGG + Intergenic
1065636535 10:27741564-27741586 GCCCGGGCTTGGCCGGGGCGTGG - Intronic
1066759381 10:38738649-38738671 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1066759388 10:38738666-38738688 GCCAGGGCAGGGCCAGGGCCAGG - Intergenic
1066962095 10:42233650-42233672 GCCGGGGCATGGAAAGGGCCGGG + Intergenic
1066962230 10:42234095-42234117 GCCAGGGCAGGGCCAGGGCCAGG + Intergenic
1066962246 10:42234130-42234152 GCCAGGGCCTGGGCAGGACCAGG + Intergenic
1067445101 10:46337042-46337064 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1067502316 10:46816334-46816356 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1067592271 10:47523686-47523708 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1067639387 10:48031759-48031781 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1069024143 10:63521662-63521684 GCCTGGGCCTGGGCGGGGACGGG + Intronic
1069668927 10:70185333-70185355 AGCCAGGCATGGGCCGGGCATGG - Intergenic
1070954151 10:80453942-80453964 GCCCGGCCCCGGGCCAGGCCCGG + Intergenic
1070954153 10:80453944-80453966 GGCCGGGCCTGGCCCGGGGCCGG - Intergenic
1073045024 10:100632017-100632039 GAGGGGGCATTGGCCGGGCCTGG - Intergenic
1073099620 10:100999839-100999861 GCGCGGGCCAGGGCCGGGGCCGG + Exonic
1073099623 10:100999845-100999867 GCCAGGGCCGGGGCCGGGGCCGG + Exonic
1073099627 10:100999851-100999873 GCCGGGGCCGGGGCCGGGGCCGG + Exonic
1074537224 10:114337195-114337217 GCCAGGGCTTGGGCCTGGACAGG - Intronic
1074995689 10:118755222-118755244 GGCCGGGCAGGGGGCGGGGCCGG - Exonic
1075410708 10:122225950-122225972 CCCAGGGCAGGGGCAGGGCCTGG - Intronic
1075689558 10:124386258-124386280 GGCTGGCCATGGGCAGGGCCTGG + Intergenic
1075885397 10:125895943-125895965 GCCCGGGCATGGGCCGGGCCTGG - Intronic
1076035651 10:127196624-127196646 GCGCGGGGCCGGGCCGGGCCGGG + Intronic
1076250328 10:128979657-128979679 GCCCTGGCATGGTCCAGGCCTGG + Intergenic
1076279337 10:129232523-129232545 CCCCGGGCAGGGGCAGGGGCAGG - Intergenic
1076328173 10:129644577-129644599 GCCCGTGGAAGGGCCGAGCCTGG + Intronic
1076657998 10:132037007-132037029 GCCCGCGCAGGTGCTGGGCCAGG + Intergenic
1076674837 10:132142475-132142497 GCCGGGGCCGGGGCCGGGGCAGG - Intronic
1076683255 10:132186077-132186099 TCCCGGGCCTGGGCCACGCCGGG - Intergenic
1076784517 10:132743209-132743231 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076784536 10:132743267-132743289 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076784555 10:132743325-132743347 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076857589 10:133124832-133124854 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1077076905 11:706152-706174 GGCCGGGCCGGGGCGGGGCCGGG - Exonic
1077121501 11:910942-910964 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1077121506 11:910948-910970 GCCGGGGCCGGGGCCGGGGCGGG + Intronic
1077141599 11:1027239-1027261 GACCGGGCAGGGGCCAGGCGGGG - Intronic
1077217299 11:1400299-1400321 GCCCGGGCATGGGGTGGGCCTGG + Intronic
1077253701 11:1571663-1571685 GGGCGGGCGTGGGCTGGGCCCGG + Intronic
1077360423 11:2138190-2138212 GGCCGGGCCGGGGCCGGGGCTGG - Intronic
1077495485 11:2884852-2884874 GCCGGGGCGGGGGCCGGGGCCGG + Exonic
1077495492 11:2884864-2884886 GCCGGGGCCGGGGCCGGGGCCGG + Exonic
1077495496 11:2884870-2884892 GCCGGGGCCGGGGCCGGGGCTGG + Exonic
1077610744 11:3642001-3642023 GGCGGGGCGTGGGCGGGGCCTGG + Exonic
1078334184 11:10450912-10450934 GCCGGGGCCAGGGCCCGGCCAGG - Exonic
1079122511 11:17695901-17695923 GCCAGGGCCGGGGCCGGGGCCGG + Intergenic
1079122515 11:17695907-17695929 GCCGGGGCCGGGGCCGGGCCGGG + Intergenic
1080595971 11:33774529-33774551 GGCGGGGCAGGGGCGGGGCCAGG - Intronic
1080836260 11:35943957-35943979 AGCCGGGCCGGGGCCGGGCCCGG + Intergenic
1081371808 11:42313265-42313287 GCCTGTTCATGGGCCGGGCACGG - Intergenic
1081549307 11:44096586-44096608 GCCCGGGGGTGTGTCGGGCCGGG + Intronic
1081636781 11:44727057-44727079 GCCGGGGCTGGGGCCGGGGCCGG - Intronic
1081636789 11:44727069-44727091 GCCGGGGCCGGGGCCGGGGCTGG - Intronic
1081636793 11:44727075-44727097 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1081636797 11:44727081-44727103 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1083024952 11:59542886-59542908 AGCCGGGCATTGGCCGGGCATGG + Intergenic
1083303767 11:61752572-61752594 GGGCGGGCAGGGGCCGGGCCAGG + Intergenic
1083321775 11:61852109-61852131 GCCCGGGCTTGGCCTGGGCTGGG + Intronic
1083869039 11:65475849-65475871 AGCCGGGCGTGGGCCGGGCGCGG - Intergenic
1083994643 11:66266018-66266040 TCCGGGGCCTGGGCCGGGTCGGG + Intronic
1083995070 11:66267658-66267680 GGCCGTGCCTGGGCGGGGCCGGG - Exonic
1084038009 11:66524908-66524930 AGCCGGGTATGGGCCGGGCACGG + Intronic
1084112516 11:67023286-67023308 GCCGGGGGCTCGGCCGGGCCGGG - Intronic
1084130390 11:67129442-67129464 AGCCGGGCATAGGCCGGGCGCGG + Intronic
1084165580 11:67373415-67373437 CCCCGCGCCGGGGCCGGGCCAGG - Intronic
1084336607 11:68461203-68461225 GACCGGGCGCGGGCCGGGCGGGG - Intronic
1084378157 11:68792521-68792543 GCCTGGGCCTGGGCCTGGCCTGG + Intronic
1084556680 11:69879887-69879909 GCCCAGGAAGGGGCCAGGCCTGG - Intergenic
1084675274 11:70630367-70630389 GCCCAGGCAGAGGCGGGGCCAGG + Intronic
1084682349 11:70673729-70673751 CCTCCGGCATGGGCCTGGCCTGG - Intronic
1084726267 11:70944328-70944350 CACCGGGCAGAGGCCGGGCCGGG - Intronic
1084889763 11:72230904-72230926 GCCCGGGCTGGGGCTGGGGCGGG + Intronic
1084892617 11:72244016-72244038 GCGGGGGCGGGGGCCGGGCCAGG + Exonic
1088801931 11:113314555-113314577 GCCTGGGCTGGGGCGGGGCCAGG - Exonic
1089194800 11:116688011-116688033 CCCTGGGCATGGGCAGGGGCAGG + Intergenic
1089533852 11:119149213-119149235 GCCCGGGCCGGGGCGGGGCCGGG - Exonic
1089593428 11:119559708-119559730 GCTGGGGCATGGGGAGGGCCTGG + Intergenic
1089620912 11:119721693-119721715 GCCAGGGTGTGGGCCTGGCCCGG - Intronic
1089679150 11:120109846-120109868 GCCCAGGCATGGGACAGGCAAGG + Intergenic
1090646586 11:128771331-128771353 TCTCGTGCATGGGCAGGGCCTGG + Intronic
1090666756 11:128919406-128919428 GCCCGGGCTCGGGCCAGGCAGGG - Exonic
1090792747 11:130105991-130106013 GCACAGGCATCGGCCGGGCGTGG - Intronic
1092229025 12:6766680-6766702 GCCGGGGCCGGGGCCGGGGCTGG - Exonic
1092246634 12:6867707-6867729 GGCCGGGCCGGGGCCGGGGCCGG + Intronic
1092246638 12:6867713-6867735 GCCGGGGCCGGGGCCGGGGCAGG + Intronic
1092385181 12:8031622-8031644 GCCTGAGTATGGGCCGGGCGCGG + Intergenic
1094124965 12:27014180-27014202 GCCCTGGCGTGGGCCCAGCCCGG - Exonic
1095986259 12:48001627-48001649 GCCGGCGCAGGGGCGGGGCCAGG + Intronic
1096435902 12:51591089-51591111 GCCCGGGCAGGGGGCGCGCGCGG + Intronic
1096475698 12:51907561-51907583 GCCCGGTCCGGGGCCGCGCCCGG + Exonic
1096675086 12:53221837-53221859 GGCGGGGGAAGGGCCGGGCCGGG - Intronic
1096796746 12:54082579-54082601 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1096796750 12:54082585-54082607 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1096796754 12:54082591-54082613 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1096796758 12:54082597-54082619 GCCGGGGCCGGGGCCGGGCTGGG + Intergenic
1097192210 12:57224993-57225015 GCCTAGGCGTGGGCCGCGCCTGG + Exonic
1100611538 12:96194930-96194952 GCCCGAGCTCGCGCCGGGCCCGG + Intronic
1100844548 12:98645151-98645173 GCGCGGGCATGAGCCGTGGCAGG + Exonic
1102039947 12:109794293-109794315 GACCGGGCAGGGGCTGGGGCAGG - Intronic
1102151013 12:110689164-110689186 GCCCGGGCGGGGGCGGGGCCTGG - Intronic
1102238741 12:111310555-111310577 GCCAGGGCTTGGGCCGGGCTAGG - Exonic
1102248332 12:111368967-111368989 GCCCGGCCATGGTTCGGGACTGG + Exonic
1103321113 12:120093379-120093401 GCCCAGGCGTGGGCTTGGCCAGG - Exonic
1103359089 12:120342960-120342982 AGCAGGGCAGGGGCCGGGCCCGG + Exonic
1103373658 12:120438332-120438354 GCGCCGGTATGGGGCGGGCCCGG - Intronic
1103506399 12:121444387-121444409 GGGCGGGCCTGGGCCTGGCCGGG - Intronic
1103563475 12:121804290-121804312 GCTCGGGCCAGGGCCGGGGCCGG - Intronic
1103779412 12:123389154-123389176 GCGCCGCCATGGGCCTGGCCGGG + Intronic
1103954166 12:124567331-124567353 GCCCGGGCTTGGGGCGCGCTCGG + Intronic
1104376183 12:128267097-128267119 GCCCGGGCGGGGGCGGGGGCGGG + Intergenic
1104697156 12:130872197-130872219 GCCGGGGCCAGGGCCGGGGCGGG + Intronic
1104726150 12:131076921-131076943 GGGCTGGCATGGGGCGGGCCTGG - Intronic
1105217497 13:18297664-18297686 GCGCTGCCATGGGCCTGGCCGGG + Intergenic
1105975464 13:25468760-25468782 GCGTGGGCGTGGGCGGGGCCGGG + Intronic
1107133580 13:36920536-36920558 GGCCGGGCAGGGGCCGAGCCTGG - Intronic
1107806822 13:44161101-44161123 GCCAGGGCATGAGGAGGGCCAGG - Intronic
1110860502 13:80341013-80341035 GCGGGGGCGCGGGCCGGGCCGGG + Intergenic
1112328471 13:98459527-98459549 CCCCGGCCATGGGCCGTGCCTGG - Intronic
1112494785 13:99896096-99896118 GCCGGGGCCGAGGCCGGGCCAGG + Exonic
1112810036 13:103207383-103207405 TGCCTGGCATGGGCCGGGCGCGG - Intergenic
1113120245 13:106917588-106917610 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1113120249 13:106917594-106917616 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1113120253 13:106917600-106917622 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1113120257 13:106917606-106917628 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1113120261 13:106917612-106917634 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1113312038 13:109141000-109141022 GCCCGGGCGGGGGCGGGGGCGGG - Exonic
1113769232 13:112897979-112898001 GCCGGGGCCGGGGCCGGGGCTGG - Intronic
1113836915 13:113334123-113334145 GCACAGGCATGGGCCAGGCGCGG - Intronic
1113874256 13:113584792-113584814 GCGCGGGCTGGGGCCGGGCCGGG - Exonic
1113874399 13:113585155-113585177 GCCGGGGCCGGGGCCGGGGCTGG + Intronic
1115753792 14:36514697-36514719 GCCCGGGCTTGGGCTAGGCTGGG + Intergenic
1115851664 14:37594728-37594750 GGCCGGGCCTTGGCCGGGCCTGG - Intronic
1117979420 14:61327958-61327980 GACTGGGCCTGGGCCGGGCGCGG + Intronic
1118363610 14:65076105-65076127 CCCCGGGCATGTGCCCGGCAGGG + Exonic
1118909058 14:70046211-70046233 TCCTGGGCATCGGCCTGGCCTGG - Exonic
1119405305 14:74395161-74395183 GCCTGGGCAGGGGCCGGAGCTGG + Intergenic
1119743521 14:77028509-77028531 GCCCGGGCGCCGGCCAGGCCTGG - Exonic
1119781663 14:77280108-77280130 GGCCGAGGATGGGCTGGGCCTGG - Intronic
1121050362 14:90816067-90816089 GCGCGGGCAGGGGCGCGGCCGGG - Intronic
1121329608 14:93041618-93041640 GCCCGGGTGTGGGCTGGGCAGGG - Intronic
1121850774 14:97219499-97219521 GCGCTCGCCTGGGCCGGGCCGGG - Intergenic
1122358023 14:101135929-101135951 GCCTGGGCATGGACCAGACCTGG - Intergenic
1122582210 14:102777796-102777818 GGCCGGGCCTGCGCCGCGCCGGG - Intronic
1122650019 14:103220968-103220990 GCCCGCGCAGGGGCCGGGCGAGG + Intergenic
1122672964 14:103385853-103385875 GCCGGGGGACGGCCCGGGCCAGG + Exonic
1122889017 14:104724158-104724180 GGCGGGGCAGGGGGCGGGCCGGG - Intergenic
1122889025 14:104724170-104724192 GCCGGGGCAGGGGGCGGGGCAGG - Intronic
1123053721 14:105559769-105559791 GCACGGGCAGGGGCAGGGGCAGG - Intergenic
1123060398 14:105591797-105591819 GGCAGGACCTGGGCCGGGCCAGG - Intergenic
1123078295 14:105680168-105680190 GCAGGGGCAGGGGCAGGGCCAGG - Intergenic
1123078306 14:105680192-105680214 GCACGGGCAGGGGCAGGGGCAGG - Intergenic
1123084876 14:105712768-105712790 GGCAGGGCCTGGGCCGGGCCAGG - Intergenic
1202872654 14_GL000225v1_random:177974-177996 GCCCGGGCATGGGCCGGGCCTGG + Intergenic
1202930217 14_KI270725v1_random:28577-28599 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1123422159 15:20142923-20142945 GCAAGGGCAGGGGCAGGGCCAGG + Intergenic
1123442955 15:20303815-20303837 GCCGGGGCAGGGCCAGGGCCAGG - Intergenic
1123531387 15:21149463-21149485 GCAAGGGCAGGGGCAGGGCCAGG + Intergenic
1124500444 15:30223300-30223322 GCCCGCGCCGGGGCCGGGGCCGG + Intergenic
1124500449 15:30223306-30223328 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1124629027 15:31326801-31326823 CCCCGGGGGTGGGCGGGGCCGGG - Intergenic
1124629381 15:31328016-31328038 GCCCGGGGAGGGGGCGTGCCCGG - Intronic
1124743125 15:32315361-32315383 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1124790131 15:32718906-32718928 GCCCGGGCGTGCGCGGGGCGGGG - Intronic
1125526151 15:40376327-40376349 AGCTGGGCATGGGCCGGGCGCGG + Intergenic
1125903644 15:43370978-43371000 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1125903648 15:43370984-43371006 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1127071341 15:55290300-55290322 GCCGGGGGCAGGGCCGGGCCTGG - Intronic
1127293671 15:57591868-57591890 GCCGGGGGCGGGGCCGGGCCGGG - Intergenic
1127504511 15:59584771-59584793 GTCTGGTCATGGGCCGGGCATGG + Intergenic
1128378021 15:67091130-67091152 GCCAGGGCATGGGCAGGGCAGGG - Intronic
1128466623 15:67918187-67918209 GCCCGAGCAAGGCCTGGGCCAGG - Intergenic
1128547838 15:68579509-68579531 TCCCGGGGTTGGGCCGGGCGCGG - Intronic
1128557401 15:68641197-68641219 CCCCGGGGATGGGCCTGGGCAGG - Intronic
1128758824 15:70201079-70201101 GCCCTGGCATCTGCCGAGCCTGG + Intergenic
1129382893 15:75178835-75178857 GCCCGGGCATGGGCTGAACGTGG + Intergenic
1129612321 15:77070798-77070820 GGCCGGGCTTGGGCCTGGGCGGG - Intronic
1129948245 15:79560606-79560628 GCGCGGGCCGGGGCCAGGCCGGG + Intergenic
1130952536 15:88604359-88604381 GCCCGGGGAGGGGACGGGACTGG + Intergenic
1131215219 15:90530297-90530319 GGCCGGGCGGGGGCCGCGCCCGG + Intronic
1132522461 16:397818-397840 GGCCGGGCAGCGGCGGGGCCGGG - Intronic
1132544686 16:527819-527841 ACGCGGGCAGGGGCCGGGGCCGG + Intronic
1132560224 16:590124-590146 GCCCGGGCGCGGGCGGGGCGGGG + Intronic
1132600016 16:769167-769189 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1132600044 16:769215-769237 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1132719736 16:1309778-1309800 GCGCGTGCGGGGGCCGGGCCGGG + Intronic
1132745931 16:1436302-1436324 GCCCGGTGCTGGGCCAGGCCCGG + Intronic
1132779356 16:1614317-1614339 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1132779360 16:1614323-1614345 GCCGGGGCCGGGGCCGGGCAGGG + Intronic
1132844185 16:1992425-1992447 GCCCGGGTCTGGGCGGAGCCTGG + Intronic
1133170270 16:3978599-3978621 GCCCGGGCAGTGGCCGGGCTGGG - Intronic
1135619890 16:23946749-23946771 GTCTGGGGAGGGGCCGGGCCTGG + Intronic
1136116302 16:28097094-28097116 ACCTGGGCAGGGGCTGGGCCGGG - Intergenic
1136141641 16:28292544-28292566 GCCCGGGCGGGCGCCGGGGCCGG + Exonic
1136156874 16:28388917-28388939 GACCAGGCAAGGGCCAGGCCTGG - Intronic
1136188225 16:28600652-28600674 GCCCGAGCCTGAGCCGGACCCGG - Intergenic
1136190697 16:28613646-28613668 GCCCGAGCCTGAGCCGGACCCGG - Intronic
1136206212 16:28726364-28726386 GACCAGGCAAGGGCCAGGCCTGG + Intronic
1136237645 16:28924744-28924766 GGCGGGGCAGGGGCGGGGCCAGG - Intronic
1136419582 16:30123306-30123328 GCCGGGGCAAGGGCGGGGCCTGG - Intronic
1136453889 16:30369936-30369958 GCCGGGGCTGGGGCCGGGGCTGG + Exonic
1136453896 16:30369948-30369970 GCCGGGGCTGGGGCCGGGGCCGG + Exonic
1136544642 16:30948469-30948491 CCCCGGGGATGAGCCGGGCCAGG + Exonic
1136556532 16:31010570-31010592 GCAGGGGCCTGGGCCGGGCTCGG + Exonic
1136590345 16:31214652-31214674 GCCTGGGCTAGGGCTGGGCCAGG + Intronic
1136718420 16:32302310-32302332 GCCAGGGCAGGGCCAGGGCCAGG + Intergenic
1136722516 16:32337089-32337111 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1136723265 16:32340069-32340091 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1136723402 16:32340514-32340536 GCCAGGGCCTGGGCAGGACCAGG + Intergenic
1136773545 16:32859862-32859884 GCCAGGACCTGGGCAGGGCCAGG - Intergenic
1136773672 16:32860279-32860301 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1136779046 16:32885756-32885778 GCGCGGGCGTCGGCGGGGCCCGG + Intergenic
1136836795 16:33508580-33508602 GCCAGGGCAGGGCCAGGGCCAGG + Intergenic
1136840841 16:33543082-33543104 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1136841602 16:33546130-33546152 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1136862570 16:33712383-33712405 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1136871037 16:33808521-33808543 GGCGGGGCAGGGGGCGGGCCTGG - Intergenic
1136891572 16:33975762-33975784 GCGCGGGCGTCGGCGGGGCCCGG - Intergenic
1136896940 16:34001240-34001262 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1136897067 16:34001657-34001679 GCCAGGACCTGGGCAGGGCCAGG + Intergenic
1137559246 16:49492474-49492496 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1137665501 16:50246731-50246753 TCCGAGGCAGGGGCCGGGCCTGG - Intronic
1137783045 16:51114029-51114051 GCCCGGGCCTGGGAGGGGGCAGG + Intergenic
1138265236 16:55655845-55655867 GGCCGGGGATGGGCAGGGGCGGG - Intronic
1138536604 16:57663649-57663671 GCCTGGGGCTGGGCCGGGCTCGG - Exonic
1138548784 16:57735896-57735918 GCCCTGGGCTGGGCCGAGCCAGG + Intronic
1138561322 16:57802407-57802429 GCCCGGGGCTCGGCCCGGCCCGG + Exonic
1138604822 16:58081835-58081857 GCCTGGGCTTGGCCCGGGGCAGG + Intergenic
1139485743 16:67255700-67255722 GCCCGGGTAGGGTCCGGGCCAGG + Intronic
1139511606 16:67431203-67431225 GGCGGGGCGGGGGCCGGGCCGGG - Exonic
1139544781 16:67645075-67645097 GGGCGGGGAGGGGCCGGGCCGGG + Exonic
1139891059 16:70253530-70253552 GCCAGGGTAGGGGCAGGGCCCGG - Intronic
1140480764 16:75261700-75261722 GCCCGGGCAGGGGAGAGGCCAGG + Intronic
1141054628 16:80804056-80804078 GACCGGGCCGGGGCCGGGGCCGG - Intronic
1141623927 16:85251580-85251602 CCCTGGGCAGGGGCTGGGCCCGG + Intergenic
1141694119 16:85611929-85611951 GCGCGGGCATGTCCCGGGGCAGG + Intronic
1141948584 16:87326245-87326267 GCCCAGGCATGGGCCACGCAGGG - Intronic
1141972290 16:87492338-87492360 GCGCGGGCCGGGGCCGGGTCCGG + Intergenic
1142289005 16:89184178-89184200 GCCTGAGCCTGGGCCAGGCCTGG - Intronic
1142414755 16:89935294-89935316 GCTCGGGCACGGTCAGGGCCCGG - Exonic
1203003030 16_KI270728v1_random:177251-177273 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1203003167 16_KI270728v1_random:177696-177718 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1203003915 16_KI270728v1_random:180675-180697 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1203008008 16_KI270728v1_random:215455-215477 GCCAGGGCAGGGCCAGGGCCAGG - Intergenic
1203075961 16_KI270728v1_random:1121973-1121995 GCCAGGACCTGGGCAGGGCCAGG - Intergenic
1203076050 16_KI270728v1_random:1122269-1122291 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1203081459 16_KI270728v1_random:1147845-1147867 GCGCGGGCGTCGGCGGGGCCCGG + Intergenic
1203101135 16_KI270728v1_random:1307537-1307559 GGCGGGGCAGGGGGCGGGCCTGG + Intergenic
1203134635 16_KI270728v1_random:1713657-1713679 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1203134773 16_KI270728v1_random:1714102-1714124 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1203135523 16_KI270728v1_random:1717082-1717104 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1203146973 16_KI270728v1_random:1808859-1808881 GCCAGGGCAGGGCCAGGGCCAGG + Intergenic
1203151006 16_KI270728v1_random:1843379-1843401 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1203151767 16_KI270728v1_random:1846427-1846449 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1142836759 17:2593507-2593529 GCGCCGGGCTGGGCCGGGCCGGG - Intronic
1142989933 17:3723802-3723824 GCCAGGGCCGGGGCCGGGACGGG - Intronic
1143323155 17:6080931-6080953 GGCCGGGCCGGGGCCGGGTCAGG - Exonic
1143883330 17:10047209-10047231 GCCAGGGCATTGGCTGGGCTTGG - Intronic
1143904621 17:10198742-10198764 GCCGGGGCCGGGGCCGGGACCGG + Intergenic
1144065719 17:11622489-11622511 GGCCAGGCATGGGCTGGGGCTGG - Intronic
1144659027 17:17056448-17056470 GCAGGGGCAGGGGCCGGGGCTGG + Intronic
1144676601 17:17166158-17166180 GCCCCGCCATGGGCTGGGGCCGG - Intronic
1144787585 17:17840470-17840492 GGTCGGGCAGGGGCCGGGCTGGG - Intergenic
1144847163 17:18225881-18225903 GCGCGGGGCGGGGCCGGGCCGGG + Intronic
1144953906 17:19009594-19009616 TCCCGAGAATGTGCCGGGCCTGG + Intronic
1145777656 17:27540573-27540595 GTGCGGGTATGGGCCGGGCCGGG + Intronic
1145930699 17:28683219-28683241 GCCTGCGGATGGGCTGGGCCAGG - Intronic
1147139649 17:38453935-38453957 GCCGGGGCAGTGGCCGGGCCCGG + Intronic
1147139721 17:38454155-38454177 GCCGGGGCCGGGGCCGGGGCAGG + Intronic
1147145339 17:38481435-38481457 AGCCGGGCGTGGGCCGGGCGCGG - Intronic
1147223734 17:38958117-38958139 GGCTGGGCTTGGGCCGGGCATGG - Intronic
1147336747 17:39730665-39730687 CCCCGGGCAGGGGCTGGGTCCGG + Exonic
1147440371 17:40443776-40443798 GCCCAGGCTCGGCCCGGGCCCGG - Exonic
1147954545 17:44124987-44125009 GGCCGGGCGTGGGCCGGGCATGG + Intergenic
1147966944 17:44199089-44199111 GCCGGGGCCGGCGCCGGGCCGGG + Intronic
1147986251 17:44309128-44309150 GCCCGGGCATAGGCTTGGCTTGG - Intronic
1148107780 17:45128445-45128467 GCCCTGGCAGGTGCCTGGCCTGG - Intronic
1148437698 17:47695730-47695752 GCGGAGGAATGGGCCGGGCCCGG + Exonic
1148689710 17:49520199-49520221 GCCCGGGCATGGCCCAGGGCAGG - Intergenic
1148930081 17:51120763-51120785 GCCCGGGCCGGGGCTGGGGCTGG + Exonic
1148930085 17:51120769-51120791 GCCGGGGCTGGGGCTGGGCCCGG + Exonic
1149804042 17:59597644-59597666 TCCTGGGCTTGGGCCGGGCACGG + Intronic
1149842454 17:59977834-59977856 TCCTGGGCTTGGGCCGGGCACGG - Intergenic
1150217204 17:63477350-63477372 GCCCGGGCCCGGGCGGGGGCGGG + Intergenic
1150217210 17:63477356-63477378 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
1150653542 17:67025012-67025034 GCCCGGGCTGGTGCTGGGCCGGG + Intronic
1150791883 17:68205738-68205760 GCCGGGGCAGGGGCCGGGGCAGG - Intergenic
1151222330 17:72622354-72622376 GCCTGGGCTTGGGCTGGGCTTGG + Intergenic
1151612040 17:75182677-75182699 GCCCGGGCCTGAGCCGCGGCCGG + Intergenic
1151724938 17:75878262-75878284 GCCAGGGCAGGGGCCGGGCCGGG + Exonic
1151724942 17:75878273-75878295 GGCCGGGCCGGGGCCGGACCCGG + Exonic
1151756161 17:76076411-76076433 GCCTGGAAATGGGGCGGGCCCGG - Intronic
1152364043 17:79844890-79844912 GCCCAGGCAGGGCCCGGGCAGGG + Intergenic
1152396370 17:80035924-80035946 GGCCGGGCCGGGGGCGGGCCCGG - Intergenic
1152396375 17:80035935-80035957 GGGCAGGCAGGGGCCGGGCCGGG - Intergenic
1152552011 17:81034797-81034819 GCCCGGGCAACAGCCGGGCTGGG - Intergenic
1153331468 18:3879469-3879491 GCCCGGGGAGGTGCTGGGCCGGG + Exonic
1154125607 18:11689657-11689679 GCCAGGGCCGGGGCCGGGGCGGG - Exonic
1154175729 18:12086588-12086610 GCCAGTGCAAGGGCAGGGCCAGG - Intergenic
1154175857 18:12087030-12087052 GCCAGGGCCTGGGCGGGGCCAGG - Intergenic
1154204504 18:12325632-12325654 GCTCGGGCACGGTCAGGGCCCGG - Exonic
1154414882 18:14171343-14171365 GCCAGGGCAAGGGGAGGGCCAGG + Intergenic
1154415065 18:14171969-14171991 GCCGGGGCAGGGCCAGGGCCAGG + Intergenic
1154415449 18:14173350-14173372 GCCGGGGCAGGGCCAGGGCCAGG + Intergenic
1154415555 18:14173730-14173752 GCACAGGCAGGGGCAGGGCCTGG + Intergenic
1155461595 18:26090421-26090443 GCGGGGGGAAGGGCCGGGCCCGG - Intronic
1156249970 18:35343852-35343874 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1157294626 18:46433563-46433585 GCCAGGGCGTGGGCAGGGCCAGG + Intronic
1157662846 18:49460583-49460605 GCCCGGGCTGGAGCCGAGCCGGG - Exonic
1158931093 18:62325479-62325501 GCCCCGGGAAGGGCCGGGGCCGG + Intronic
1158953807 18:62522379-62522401 GCCTGGGCGTGGGCGCGGCCCGG + Intergenic
1160013817 18:75125852-75125874 TCCCGGGCTTGCGCCTGGCCTGG - Intergenic
1160024881 18:75209096-75209118 GCCCGGGCGGGGGCCGACCCCGG - Exonic
1160163216 18:76491276-76491298 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1160228170 18:77027444-77027466 CCCTGGGCAGGGGCAGGGCCAGG + Intronic
1160242517 18:77133284-77133306 AGCCGGACATGGGCCTGGCCTGG - Intronic
1160526988 18:79544048-79544070 GCCTGGGCACCGGCTGGGCCGGG - Intergenic
1160592387 18:79951694-79951716 GCTCCGGCGTGGGCGGGGCCCGG - Intergenic
1160613871 18:80109483-80109505 GCGCGGGCCCGCGCCGGGCCGGG - Intronic
1160631213 18:80247431-80247453 GCGCGGGCCGGGGCCGGGGCCGG - Exonic
1160675869 19:390950-390972 GCCAGGGCGGGGGCCGGGGCGGG - Intergenic
1160719297 19:590344-590366 GCCCGCGCCGGGGCCGGGGCCGG + Exonic
1160724847 19:613558-613580 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1160726149 19:618671-618693 GCCCGGGCTGGGGCCTGGCCGGG - Intronic
1160739415 19:679148-679170 GCCTGGGCATGAGACGGCCCAGG + Intronic
1160781142 19:878430-878452 GCCGGGGCCGGGGCCGGGGCTGG - Intronic
1160781297 19:878914-878936 GCCGGGGCCGGGGCCGGGGCTGG - Intronic
1160781301 19:878920-878942 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1160781305 19:878926-878948 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1160862698 19:1244462-1244484 GCCCGGCCAGGGGCTGGGCAGGG + Exonic
1160930675 19:1568218-1568240 GCTCGGGGCCGGGCCGGGCCGGG + Intergenic
1160951700 19:1670710-1670732 AGCCGGGCATGGGCCGGGCGCGG - Intergenic
1160971522 19:1769868-1769890 GCTGGGGGAGGGGCCGGGCCAGG - Intronic
1160989683 19:1855437-1855459 TCCCGGGAAGGGGCGGGGCCCGG + Intronic
1161170150 19:2808455-2808477 GCCCGGGCAGGGGCAGGGGCAGG + Intronic
1161210442 19:3062652-3062674 GCCCGGGGCGGGGGCGGGCCGGG - Intronic
1161215806 19:3094579-3094601 GCTCCGGCCAGGGCCGGGCCGGG + Exonic
1161311387 19:3595980-3596002 CCCCGGGCAGGGACCGGGGCGGG - Intronic
1161326835 19:3668144-3668166 GCCCAGGCCTGGGCTGAGCCGGG + Intronic
1161343319 19:3754216-3754238 GCACGCGCATGGCCCAGGCCCGG - Exonic
1161479154 19:4502022-4502044 GCTCGGGCGGGGGCTGGGCCTGG - Exonic
1161500752 19:4614038-4614060 GGCTGGGCTTGGGCCGGGCACGG - Intergenic
1161505080 19:4639508-4639530 GCCGGGGCCGGGGCCGGGGCGGG - Intronic
1161512975 19:4682136-4682158 GCCTGGGCATGGGCCGGGCGCGG - Intronic
1161726705 19:5933515-5933537 GCCTGGGCTGGGGCTGGGCCTGG + Intronic
1161865387 19:6829002-6829024 GCCTGGGCAGGGGCGGGGCCGGG + Intronic
1161865401 19:6829071-6829093 GCCTGGGCAGGGGCAGAGCCAGG + Intronic
1162026822 19:7899087-7899109 GCCATGGCAGGGACCGGGCCGGG + Exonic
1162033085 19:7925703-7925725 GGCCGGGCATGGGCGTAGCCCGG - Intronic
1162675462 19:12295001-12295023 GCCCTGCCAGGGGCCGGGTCTGG - Intergenic
1162780960 19:13006874-13006896 GCCCGGGCATGGGGTGGGGGTGG - Intronic
1162801063 19:13110675-13110697 GCTGGGGCCTGGGCCGGGCGTGG + Intronic
1162817323 19:13203956-13203978 GCCCAGGCATTGGCCGGGCGCGG - Intergenic
1162901017 19:13795618-13795640 GCCGGGGCCAGGGCCGGGGCGGG - Exonic
1162909903 19:13842977-13842999 GGCCGGGCAGGGGGCGGGCGCGG + Intergenic
1163158064 19:15449713-15449735 GCCCCGGGCCGGGCCGGGCCAGG - Intronic
1163325374 19:16600080-16600102 GCCTGGGCCTGGGCCTGGGCTGG - Intronic
1163390293 19:17026679-17026701 GGCCGGGCCAGGGCTGGGCCAGG + Exonic
1163407218 19:17130324-17130346 AGCCGGGCATTGGCCGGGCACGG + Intronic
1163575712 19:18109899-18109921 GCGAGGGCAGAGGCCGGGCCGGG + Intronic
1163578310 19:18123395-18123417 GCCCAGGGAGGGGCCGGGGCTGG - Intronic
1163598339 19:18233267-18233289 TCCCGGCCCTGGGCCGGACCCGG - Exonic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1163767597 19:19172101-19172123 GCCAGGGCCTGGGCCAGGCTGGG + Intronic
1163821614 19:19499442-19499464 CCCAGGGCAGGGGCAGGGCCTGG + Intronic
1164680647 19:30131715-30131737 GCCCGGGCAGGCACCGGGCTAGG - Intergenic
1165062431 19:33211362-33211384 GCCGGGGCAGGGGCCTGGGCAGG + Intronic
1165236474 19:34426251-34426273 GCCGGGGCCGGGGCCGGGCCAGG + Intergenic
1165311380 19:35030958-35030980 GCCCGGGGATGGGCCGGGGGTGG - Intronic
1165349384 19:35268087-35268109 GCGCGGGCGCGGGCCGGGCCAGG - Intergenic
1165459502 19:35936442-35936464 GGCCGGGCGGGGGCCGGGCTGGG - Intronic
1166105708 19:40597154-40597176 GCGGGGGCAGGGGCGGGGCCGGG + Intronic
1166745565 19:45140393-45140415 GCCAGGGCAGGGGCTGGGCCTGG + Intronic
1166863944 19:45825130-45825152 GCCCGTGGGTGGGCAGGGCCTGG + Intronic
1167268734 19:48496591-48496613 AGCCAGGCATGGGCCGGGCATGG - Intronic
1167524200 19:49973413-49973435 GCCCAGGCATGACCGGGGCCAGG - Intergenic
1167567707 19:50267235-50267257 GCCAGGGTATGGGCCGGGTAGGG + Intronic
1167649007 19:50719531-50719553 GCCCGGGGAGGGGGCGGGCGGGG + Intergenic
1167674887 19:50877860-50877882 GCCCAGGCAGGGGCAAGGCCTGG - Intronic
1168153525 19:54461277-54461299 CCCCCGGCATGGGATGGGCCAGG - Exonic
1168316470 19:55486780-55486802 GCCCGGGCTCGGGCCTGGGCTGG + Exonic
1202691092 1_KI270712v1_random:96173-96195 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
925448234 2:3946256-3946278 GCAGGGGCAGGGGCCAGGCCTGG + Intergenic
926055290 2:9770808-9770830 GCCCAGGCCAGGGCCGGGGCAGG - Intergenic
926151291 2:10427014-10427036 GCCCTGGAAGGGACCGGGCCAGG - Exonic
926162363 2:10498014-10498036 GGCCGTGCCGGGGCCGGGCCGGG + Intergenic
926246150 2:11123581-11123603 GCCAGGGCCAGGGCCAGGCCAGG + Intergenic
926422930 2:12716831-12716853 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
927667509 2:25042525-25042547 GCACCGGCACGCGCCGGGCCTGG - Intronic
929151165 2:38750562-38750584 GCCTCGGTAGGGGCCGGGCCAGG + Intronic
930411054 2:51027452-51027474 GCCGGGGCCTGGGCGGGGCTCGG - Intronic
930701095 2:54457696-54457718 CCCCGGGCCTGGGTGGGGCCGGG - Intronic
931602541 2:64019046-64019068 ACCCGGGCTCGGGCCCGGCCGGG - Exonic
931727959 2:65129659-65129681 GCCCGGGCCTGGACCGGGTCAGG - Intronic
932316938 2:70790696-70790718 GCCCGGGCGGGGGCGGGGCGGGG + Intergenic
932608065 2:73177437-73177459 GCGCGGGAAAGGGCCGTGCCGGG - Intergenic
932621772 2:73269085-73269107 CCCGGGGCAAGGGCCGGGGCCGG + Exonic
932699758 2:73984798-73984820 GCCCGGCCCGGGGCCCGGCCGGG + Intergenic
932812426 2:74835623-74835645 GGCCGGGGACGGGCAGGGCCAGG + Intronic
933902978 2:86862315-86862337 GCCCCGGGCTGGGCTGGGCCTGG + Intergenic
933955301 2:87357778-87357800 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
934238692 2:90250806-90250828 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
934239489 2:90253991-90254013 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
934322709 2:91983017-91983039 GCCAGGGCAGGGCCAGGGCCAGG - Intergenic
934322839 2:91983455-91983477 GGCAGGGCAAGGGCCGGGGCAGG - Intergenic
934323588 2:91986512-91986534 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
934461114 2:94214137-94214159 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
934461413 2:94215118-94215140 GGCAGGGCAGGGGCAGGGCCAGG - Intergenic
934461933 2:94217345-94217367 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
935777567 2:106486955-106486977 GCCCCGGGCTGGGCTGGGCCTGG - Intergenic
937357262 2:121205846-121205868 GCCCGGGCCTGGGGGTGGCCAGG - Intergenic
938473703 2:131589322-131589344 GCCCAGCCATGGCCCCGGCCCGG - Intergenic
938727466 2:134120710-134120732 CCGCAGGCGTGGGCCGGGCCGGG + Intronic
940009415 2:149038639-149038661 GCGCGGGAGGGGGCCGGGCCGGG - Exonic
940038120 2:149330780-149330802 GCCCCGGCTTAGGCGGGGCCTGG + Intronic
941025908 2:160455971-160455993 GCTTGGGAATGGGCCGGGCGCGG - Intronic
941666358 2:168247287-168247309 GCCGGGGCCGGGGCCGGGGCCGG + Exonic
942448330 2:176092855-176092877 GCCAGGGCCAGGGCCGGGGCCGG + Intergenic
942448333 2:176092861-176092883 GCCAGGGCCGGGGCCGGGCCAGG + Intergenic
942448341 2:176092883-176092905 GCCGGGCCATGAGCCGCGCCGGG + Exonic
944373431 2:199012057-199012079 GCCTGGCCATGGGACAGGCCTGG + Intergenic
946407317 2:219498565-219498587 GCCCTGGAAGGGGCGGGGCCAGG - Intergenic
947187945 2:227472030-227472052 GCTGAGGCATGGGCCGGGTCTGG - Intergenic
947590839 2:231384245-231384267 GCAGGGGCAGGGGCAGGGCCAGG - Intergenic
947622072 2:231597279-231597301 GGCCGGGTGTGGGCCAGGCCAGG + Intergenic
947733350 2:232442769-232442791 CCCTGGCCCTGGGCCGGGCCGGG - Intergenic
948060942 2:235042943-235042965 GCCCGAGCACAGGCTGGGCCGGG - Exonic
948305601 2:236944804-236944826 GCCCGGGTGTGGGCTGGGACTGG - Intergenic
948393335 2:237627567-237627589 GCCGGGGCCGGGGCCGGGCCGGG + Intronic
948479601 2:238241156-238241178 GCCGGGGCAGGAGCCGGGCAGGG - Intergenic
948697286 2:239738163-239738185 GCCGGGGCTGGGGCCGGGGCTGG - Intergenic
948697316 2:239738211-239738233 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
948697320 2:239738217-239738239 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
948697367 2:239738314-239738336 GCCGGGGCTGGGGCCGGGGCTGG - Intergenic
948697374 2:239738326-239738348 GGCTGGGCCTGGGCCGGGGCTGG - Intergenic
948862010 2:240757210-240757232 GCCCTGGGAGGGCCCGGGCCAGG + Intronic
948896368 2:240929784-240929806 GCCCCAGCAGGGGCCAGGCCTGG + Intronic
949019875 2:241735000-241735022 GCCCGGGCAGGGGGAGGGCCCGG + Intronic
1168831016 20:845295-845317 GCCGGGTGATGGGCAGGGCCGGG - Exonic
1168869792 20:1118608-1118630 GCCCGGGGACGGGGCGGGGCGGG - Exonic
1169141909 20:3231271-3231293 GCGGGGGCATGGGCCGGACAGGG - Intronic
1170629940 20:18057508-18057530 GCGCGCGCGGGGGCCGGGCCTGG - Intronic
1171484345 20:25476598-25476620 GCCGGGGCAGGGGCGGGGGCCGG + Exonic
1172118366 20:32584326-32584348 GCCCGGGCCGTGGCCGTGCCGGG - Intronic
1172118706 20:32585477-32585499 GGCCGGGCGGGGGCTGGGCCCGG - Intronic
1172146625 20:32762330-32762352 GGCGGGGCAAGAGCCGGGCCGGG + Intergenic
1172443199 20:34979812-34979834 CCCCGCCCATGGCCCGGGCCTGG - Intronic
1172533506 20:35652815-35652837 GCCAGGGCCGGGGCCGGGGCCGG + Exonic
1172671834 20:36640015-36640037 GCCCTGGCAAGGGCCAGGCATGG + Intronic
1173166267 20:40689069-40689091 GCCCGCGCAGGGACCGGGCCGGG + Exonic
1174204241 20:48827744-48827766 GGCCGCGCACGGGCCGGGGCCGG + Exonic
1174243482 20:49157766-49157788 ACCCAGGTATGGGCCGGGCATGG - Intronic
1174363075 20:50040452-50040474 GCAGGGGCAGGGGCAGGGCCAGG + Intergenic
1175240629 20:57545653-57545675 GACCTGGCATGGGAAGGGCCAGG + Intergenic
1175429328 20:58891146-58891168 GGCCGGGGACGGGACGGGCCGGG - Intronic
1175800417 20:61798180-61798202 GCCCGGGGCAGGGCCGGGCGGGG - Intronic
1175847178 20:62065250-62065272 GCCAGGGCCAGGGCCGGGGCCGG + Exonic
1175847182 20:62065256-62065278 GCCAGGGCCGGGGCCGGGGCCGG + Exonic
1175847186 20:62065262-62065284 GCCGGGGCCGGGGCCGGGGCCGG + Exonic
1175847189 20:62065268-62065290 GCCGGGGCCGGGGCCGGGCCCGG + Exonic
1175866292 20:62178929-62178951 GGCCGGGCCTGTGCCAGGCCTGG - Intronic
1175877830 20:62238733-62238755 GCCGGGGCCGGGGCCGGGGCTGG - Intronic
1176069117 20:63216823-63216845 GCCCCAGCCTAGGCCGGGCCAGG + Intergenic
1176099659 20:63359171-63359193 GCCGGGGCAGGGGCCGGGGCAGG - Intronic
1176159680 20:63641892-63641914 GAGCGGGCAGGGGCCGGGGCGGG - Intronic
1176159698 20:63641931-63641953 GAGCGGGCAGGGGCCGGGGCGGG - Intronic
1176159734 20:63642017-63642039 GAGCGGGCAGGGGCCGGGGCGGG - Intronic
1176159751 20:63642056-63642078 GAGCGGGCAGGGGCCGGGGCGGG - Intronic
1176178992 20:63740883-63740905 GCCAGGGCAGGGGCGGGCCCTGG + Intronic
1176206390 20:63890936-63890958 GCCTTTGCATGGGCCTGGCCCGG + Exonic
1176207211 20:63895486-63895508 GCCGCGGCCTGGGCCGGGGCGGG + Intronic
1176221039 20:63969548-63969570 GCGCGGGCCTCGGCCTGGCCGGG + Intronic
1176592230 21:8657159-8657181 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1176858142 21:13986928-13986950 GCCAGGGCAAGGGGAGGGCCAGG - Intergenic
1176866197 21:14056367-14056389 GCCGGGGCAGGGCCAGGGCCAGG + Intergenic
1176866826 21:14058653-14058675 GCACAGGCAGGGGCAGGGCCTGG + Intergenic
1178840555 21:36134965-36134987 GCGTGGGCAGGGGGCGGGCCCGG + Exonic
1178872182 21:36385738-36385760 GCCCGGGGAGGGGCCCGCCCCGG - Intronic
1178948398 21:36966689-36966711 GGCCGGGGCGGGGCCGGGCCTGG - Intronic
1178953831 21:37006428-37006450 GCCCGGGCAAGGGTGGGGACGGG - Intronic
1179810375 21:43865681-43865703 GCCCGGGAGGGGCCCGGGCCGGG + Intronic
1179913625 21:44462810-44462832 GCCAGGGCCTGGACAGGGCCAGG - Intergenic
1179929404 21:44557539-44557561 GCCCAGGGAGAGGCCGGGCCGGG + Intronic
1180042327 21:45287188-45287210 GCAGGGGCAGGGGCCGGGGCCGG - Intronic
1180046253 21:45307125-45307147 GCCCAGGCAGGGGCTGGGCTCGG + Intergenic
1180064282 21:45405032-45405054 GGCCGGGCAGGGGCCGGGCAGGG - Intergenic
1180064296 21:45405060-45405082 GCGCGGGCAGGGGGCGGGCGCGG - Intergenic
1180064306 21:45405082-45405104 GGCCGGGCAGGGGGCGGGGCGGG - Intergenic
1180064314 21:45405093-45405115 GGCCGGGCAGGGGCCGGGCAGGG - Intergenic
1180064319 21:45405104-45405126 GGGCGGGCAGGGGCCGGGCAGGG - Intergenic
1180064325 21:45405115-45405137 GGCCGGGCAGGGGGCGGGCAGGG - Intronic
1180275081 22:10634288-10634310 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1180285441 22:10741502-10741524 GCCCGGGCATGGGCCGGGCCTGG - Intergenic
1180549463 22:16528904-16528926 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1180549470 22:16528921-16528943 GCCAGGGCAGGGCCAGGGCCAGG - Intergenic
1180550357 22:16532399-16532421 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1180557520 22:16589867-16589889 AGCCAGGCATGGGCCGGGCATGG - Intergenic
1180843603 22:18970359-18970381 GCGCGGGCCTGGGCGGGGGCTGG - Intergenic
1181023692 22:20116189-20116211 GGTCGGCCTTGGGCCGGGCCAGG + Exonic
1181164650 22:20976807-20976829 GCCCAGCCAGGGGCCGGGCTGGG - Intronic
1181279945 22:21712434-21712456 GGCCGGGTATGGGCCCGGCGTGG + Intronic
1181354317 22:22289424-22289446 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1181355087 22:22292468-22292490 GCCGGGGCAGGGCCAGGGCCAGG + Intergenic
1181355128 22:22292589-22292611 GCAAGGGCAGGGGCAGGGCCAGG + Intergenic
1181811240 22:25405035-25405057 CCCCGGGGATGGCCCGGGCAGGG + Intronic
1181934641 22:26429659-26429681 GCACTGGCCTCGGCCGGGCCGGG - Intronic
1182475515 22:30574571-30574593 GCGGGGGCATGGACCAGGCCTGG - Intronic
1183173029 22:36201909-36201931 GGCAGGGCTTGGGCTGGGCCAGG - Intronic
1183180237 22:36255061-36255083 GACTGGGCTTGGGCTGGGCCAGG + Intronic
1183460315 22:37945966-37945988 AGCTGGGCATGGGCCGGGCGCGG + Intronic
1183601773 22:38844110-38844132 GCCGGGGCCAGGGCCGGCCCGGG - Intergenic
1183650829 22:39152465-39152487 GCCCGGGGCCGGGCCGGGCCGGG + Exonic
1183780301 22:39995008-39995030 GCCGGGGCCAGGGCCGGGGCCGG + Exonic
1183780305 22:39995014-39995036 GCCAGGGCCGGGGCCGGGGCCGG + Exonic
1184089234 22:42283692-42283714 GGGCGGGCAGGGGCCGCGCCGGG - Intronic
1184091018 22:42293071-42293093 TCCTGGGCTTGGGCCTGGCCAGG - Intronic
1184439198 22:44498240-44498262 GCCGGGGCAGGGGCGGGGCCGGG + Exonic
1184494194 22:44827803-44827825 GCCCAGGAGAGGGCCGGGCCTGG + Intronic
1184557444 22:45240937-45240959 GACCGGGGCCGGGCCGGGCCGGG - Intergenic
1184557447 22:45240942-45240964 GGCCGGACCGGGGCCGGGCCGGG - Intergenic
1184644304 22:45888018-45888040 GCCCGGGCCTTGGCCAGGACTGG - Intergenic
1184660425 22:45963118-45963140 GCCCAGGCATGGACTGGGCGTGG - Intronic
1184674764 22:46035787-46035809 GGCGGGGCTTGGGCGGGGCCTGG - Intergenic
1184718772 22:46297021-46297043 GCCCCGCCAGGAGCCGGGCCTGG + Intronic
1184781688 22:46652729-46652751 GCCTGGACAGGGGCCGGGGCTGG + Intronic
1185143550 22:49117187-49117209 GCAGGGGCAGGGGCAGGGCCAGG + Intergenic
1185259594 22:49854044-49854066 GACCGCGCCGGGGCCGGGCCGGG + Intronic
1185315656 22:50178189-50178211 GCGGGGGCAGGGGCGGGGCCGGG - Exonic
1185395013 22:50582438-50582460 GCCCGCGCCTGGGGCGGGGCGGG - Intronic
1185400436 22:50612879-50612901 GGCCGGGCAGGGGCGGGGCCAGG - Intronic
1185415142 22:50705574-50705596 CCACGGGCCTGGGCTGGGCCTGG - Intergenic
949510098 3:4759927-4759949 GCCAGGGCAGGGGCAGGGGCAGG - Intronic
950262449 3:11552944-11552966 ACTCGGGCCTGGGCCGGGGCTGG - Intronic
950400959 3:12768910-12768932 GCCGGGGCCGGGGCCGGGGCGGG + Intronic
950410270 3:12831580-12831602 GCCTGGGCTAGGGCTGGGCCAGG - Intronic
950669110 3:14514534-14514556 GCCCCGGGATGGGCAGGCCCTGG - Intronic
951217737 3:20040523-20040545 GCCGGGGCAGGGGCCGGGCCCGG + Exonic
953901424 3:46846069-46846091 GCCGGGGCCTGGGCCGGGGCCGG - Intergenic
954277957 3:49554664-49554686 GCCGGGGCCCGGGCCGGGGCCGG - Exonic
954278013 3:49554802-49554824 GCCCGGGCCAGGGCCGGGACCGG - Exonic
954389245 3:50260283-50260305 GCCTGGGCAGAGGGCGGGCCGGG + Intergenic
954535749 3:51358173-51358195 GCCTGGGCAGGGGCCGGGGTTGG + Intronic
954615606 3:51967519-51967541 GGGCGGGGAGGGGCCGGGCCGGG - Intronic
958900101 3:99876090-99876112 GGCCGGGCGGGGGCCGGGCCGGG + Intronic
959085740 3:101849425-101849447 GCCCGGCCATTGGCGGTGCCCGG - Intronic
960925978 3:122795240-122795262 GCCCGGGCTCGGGCCTGGGCTGG + Exonic
960989275 3:123300326-123300348 GCCCGGGGTCGGGCAGGGCCTGG - Intronic
961360555 3:126364692-126364714 GCCCTGGCATCAGCTGGGCCTGG - Intergenic
961383291 3:126509735-126509757 GCCAGGGGCTGGGCGGGGCCAGG - Intronic
961666841 3:128497943-128497965 GCCGGGGCCGGGGCCGGGGCAGG - Intergenic
961769271 3:129236772-129236794 GGCCAGGCATGGGCCAGGCGTGG - Intergenic
961817413 3:129558388-129558410 CCCTGTGCATGGGCCTGGCCTGG + Intronic
965773695 3:172207597-172207619 GGGCGGCCATGGGCGGGGCCTGG + Intronic
966181904 3:177196565-177196587 GCCCGGGCCGGGGACGCGCCCGG + Intronic
966886448 3:184380179-184380201 GCCGGGGCCGGGGCCGGGGCCGG - Exonic
967207818 3:187139545-187139567 GCCCGGGCCTGGGCGGGGCCGGG - Intronic
967694427 3:192514909-192514931 GCGCCGGCAGGGGGCGGGCCGGG + Intronic
967976971 3:195040933-195040955 GCCTGGGCATGGGCTGTGCCTGG - Intergenic
968085763 3:195873256-195873278 GCCGGGGCCTGGGCAGGGGCAGG + Intronic
968085767 3:195873262-195873284 GCCTGGGCAGGGGCAGGGGCAGG + Intronic
968186955 3:196639623-196639645 GCGCGGGGGTGGGGCGGGCCGGG - Intergenic
968450797 4:675081-675103 CCCCAGGCCTGGGCCGGGGCAGG - Intronic
968514249 4:1009772-1009794 GGCCGGGCGGGGGCGGGGCCCGG - Intergenic
968578875 4:1380511-1380533 GCCCGGGTCTGTGCTGGGCCTGG + Intronic
968724938 4:2242352-2242374 GCCTGGACAGGGGCGGGGCCTGG + Intergenic
968729420 4:2262600-2262622 TCCGGGGCGTGCGCCGGGCCGGG + Intergenic
968843969 4:3029531-3029553 GCAGGGGCAGGGGCAGGGCCTGG - Intronic
968871331 4:3244165-3244187 CCCAGGGCATGGGCCTGGCTGGG + Intergenic
968905720 4:3449716-3449738 GCCCCGGCCTGGGGCTGGCCTGG - Intergenic
969564114 4:7967579-7967601 GCCTGGGCCTGGGCCGTGCCTGG - Intronic
969613632 4:8240272-8240294 GGCCCTCCATGGGCCGGGCCAGG - Intronic
970195524 4:13547385-13547407 GCTCCGGCTTGGGCCGGCCCGGG + Intergenic
972506451 4:39724454-39724476 AGCTGGGCATGGGCCGGGCATGG + Intronic
973888551 4:55346708-55346730 GCCGGGGCATGGCCGGGGCCAGG - Intronic
974040424 4:56852583-56852605 CCACTGGCATGGGCCGGGCGCGG - Intergenic
978361111 4:107931820-107931842 GCCAGGGCGTGGGCCCGGGCGGG - Exonic
979231369 4:118352459-118352481 GCCGGGGCGTGTGCCCGGCCTGG + Exonic
979547129 4:121951436-121951458 GCGCGGGCCGCGGCCGGGCCCGG + Intronic
980405066 4:132344905-132344927 GCCGGGGCTGGGGCCGGGGCTGG + Intergenic
981782136 4:148442421-148442443 GCAGGGGCAGGGGCAGGGCCAGG + Exonic
985595217 5:784834-784856 GCCCGCGCATGCTCCGGGCCTGG - Intergenic
985611825 5:893373-893395 GCCGGGGCAGGGGCAGGGTCAGG - Intronic
985805272 5:2038872-2038894 GGCCGGGCAGGGGCCGGGCAGGG + Intergenic
985923314 5:2996471-2996493 GCCCGGGCACTGACCAGGCCAGG + Intergenic
986695943 5:10354135-10354157 TGCCGGGCAGGGGCCGGGGCCGG + Intronic
986733280 5:10650137-10650159 GCCGGGGCTGGGGCCGGGGCGGG + Exonic
987374228 5:17218589-17218611 CCCCGGGCCCGGGCCGGGGCCGG - Intronic
989588967 5:43095868-43095890 GGCCGGGCCTGGGCCAGGACAGG - Intronic
990382864 5:55233252-55233274 GCCACGGGCTGGGCCGGGCCGGG + Exonic
991489070 5:67165760-67165782 GCCCGGGTCAGGGCCAGGCCGGG - Exonic
991999260 5:72418975-72418997 AACCTGGCATGGGCCGGGCACGG - Intergenic
992732833 5:79689879-79689901 TCCCGGGCCTGGGCCGGGGCCGG - Exonic
994245473 5:97471452-97471474 GCCTGGGCATTGGCCAGGCCAGG - Intergenic
995586832 5:113656516-113656538 GCCTGGGCATGGTCCTAGCCTGG + Intergenic
998467499 5:142357286-142357308 GCTGGGGCAGCGGCCGGGCCGGG - Intergenic
998835777 5:146201806-146201828 AACCGGGCATGGGACGGGCGTGG - Intergenic
999099366 5:149010209-149010231 GCACGGGCATGGGAAGGGTCAGG - Intronic
999197814 5:149794707-149794729 GCCAGGGGATGGGCCTGGCTGGG - Intronic
999637542 5:153638529-153638551 GCTTGGGCATGGGCCGCCCCTGG - Intronic
999771926 5:154782513-154782535 GGCTGGGCCTGGGCTGGGCCAGG + Intronic
999960731 5:156753224-156753246 GGCCGGAGCTGGGCCGGGCCAGG - Intronic
1000267026 5:159647508-159647530 GTCAGGGCCTGGCCCGGGCCTGG + Intergenic
1001029494 5:168251523-168251545 GCCCGAGCGTGGGCTGTGCCTGG - Intronic
1001382117 5:171311813-171311835 GCCCGGGCCTGGGGCGGGACGGG - Exonic
1001396772 5:171423479-171423501 GACCAGGCATGAGGCGGGCCAGG + Intronic
1001617813 5:173056766-173056788 GGCCGGGGATGGGCAGCGCCGGG + Intronic
1001677707 5:173532200-173532222 GCCTGGGCATGGCCTGAGCCTGG - Intergenic
1001822387 5:174720529-174720551 GCCCGGGTTTGAGCCGGGGCTGG - Intergenic
1002006542 5:176238787-176238809 GCCGGGGCAGGGGCCAGGGCAGG + Intronic
1002060030 5:176620604-176620626 CCCGGGGCATGGACAGGGCCAGG - Exonic
1002140434 5:177134185-177134207 GGCGGGGCACGGGCCGCGCCGGG - Intronic
1002170329 5:177371066-177371088 GGCCGGGCCGGGGCCGGGGCCGG + Intronic
1002170333 5:177371072-177371094 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002170337 5:177371078-177371100 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002170341 5:177371084-177371106 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002170345 5:177371090-177371112 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002170349 5:177371096-177371118 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002170353 5:177371102-177371124 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1002219836 5:177671849-177671871 GCCGGGGCAGGGGCCAGGGCAGG - Intergenic
1002296198 5:178232627-178232649 ACCCAGGCAGGGGCGGGGCCCGG - Exonic
1002524271 5:179806723-179806745 GGCCGGGCGGGGACCGGGCCAGG + Intronic
1002645213 5:180649441-180649463 GCCCGAGCGTGGGGCTGGCCGGG - Intronic
1003086986 6:3068452-3068474 TCCCCGGCAAGGGCCGGGGCAGG + Exonic
1003116407 6:3286639-3286661 GCCCGGGCCGGGGCAGGGGCAGG + Intronic
1003218431 6:4135776-4135798 CCTGGGGCATGGGCGGGGCCAGG + Intergenic
1003248360 6:4402847-4402869 GCCCTGCCATGGGCAGTGCCAGG - Intergenic
1003624139 6:7727228-7727250 GGCCGTGCAGGGGCCGGGGCCGG - Exonic
1004044279 6:12011305-12011327 GCCCGGGCGAGGGGCGGGGCCGG + Intronic
1004195906 6:13505233-13505255 GCCCTGGCAGGAGCCAGGCCAGG - Intergenic
1005503412 6:26449862-26449884 GCCTGGGCATGTGCAGGGTCAGG - Intronic
1006022132 6:31123538-31123560 GCACGGGCACGGGCAGGGGCAGG - Intronic
1006075314 6:31528907-31528929 GCTGGGGCCTGGGCAGGGCCAGG + Exonic
1006131251 6:31870737-31870759 GCCAGGGCTGGGGCCGGGCATGG + Intronic
1006369224 6:33633834-33633856 GCGCGGGGCGGGGCCGGGCCGGG + Intronic
1006369232 6:33633850-33633872 GGCCGGGCCGGGGCGGGGCCAGG + Intronic
1006406228 6:33847310-33847332 GCCTGGCCCTGGGCCGGGCGCGG + Intergenic
1006632021 6:35436596-35436618 GCCATGGGATGGGGCGGGCCTGG + Intergenic
1006645387 6:35511749-35511771 GCCCGGGCCTGGGCTGGGTCTGG + Exonic
1006860638 6:37169938-37169960 GCGCTGGCAGGGGCGGGGCCGGG + Intergenic
1007479890 6:42142755-42142777 GGCTGGGCGTGGGCCGGGCGAGG - Intergenic
1007591155 6:43021676-43021698 GCCGGGGCCGGGGCCGGGGCCGG + Exonic
1007702795 6:43774296-43774318 GCATGGGCATGGGCAGGGGCTGG - Intronic
1007784295 6:44271055-44271077 GCCGGGGAAGGGGCCGCGCCGGG + Intronic
1007830009 6:44630634-44630656 GCTCGGGCGGGGGCCGGGGCGGG + Intergenic
1010032901 6:71288848-71288870 GCCCGGGCATGGCCGCGGCGAGG - Exonic
1011113062 6:83859751-83859773 CCCCGGGCAGGGCCCGGGGCCGG + Exonic
1011628522 6:89302606-89302628 GCTCGGGCACGGTCAGGGCCCGG - Intronic
1013372668 6:109483547-109483569 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1013372672 6:109483553-109483575 GCCGGGGCCGGGGCCGGGGCAGG + Intergenic
1015244793 6:131063379-131063401 GCCCGCGCAGGGGCGGGGCCTGG - Intergenic
1016041567 6:139437080-139437102 GCCTGGGCATGGCCCAGGGCAGG - Intergenic
1017324702 6:153131420-153131442 GCCCGGGGAGGGGGCGGGGCCGG - Intergenic
1018170540 6:161140087-161140109 GGCGGGGCATGTGCCGGGCCGGG - Intronic
1018400536 6:163415359-163415381 GCCCCGGCGGGGGTCGGGCCGGG - Intronic
1018849490 6:167576761-167576783 GTCCCTGCATGGGCAGGGCCGGG - Intergenic
1019349016 7:544501-544523 GCCCAGGCAAGGGCTGGGTCTGG - Intergenic
1019360505 7:602151-602173 GCCAGGGCAGGGGCTGGGCTGGG + Intronic
1019379149 7:712289-712311 GCGCGGGGCGGGGCCGGGCCTGG - Intronic
1019473056 7:1231430-1231452 GCCCGTGCCTGGGCCGGGGAGGG - Intergenic
1019473390 7:1232954-1232976 GCGCGGGCCGGGGCCGGGGCGGG - Exonic
1019523442 7:1470526-1470548 CCCCGGGGACGGGACGGGCCGGG + Exonic
1019616649 7:1965967-1965989 ACCCAGGCATGGGCCGACCCAGG - Intronic
1019622563 7:1999753-1999775 GCCTGGTCAGGGGCTGGGCCTGG - Intronic
1019719426 7:2559296-2559318 CCCCGCGCAGGGGCCGGCCCGGG + Intronic
1020035066 7:4959439-4959461 GCCCAGGCCTGGGGCGGCCCTGG + Intergenic
1020101654 7:5397352-5397374 GCCCGGGCAGGGGCCGGCCTGGG - Intronic
1020106543 7:5424709-5424731 GCCCGGGCCTGGGCCGAGCGGGG - Intronic
1020560556 7:9726182-9726204 GGCCGGGCCAGGGCTGGGCCAGG - Intergenic
1022489545 7:30805939-30805961 GCACGGGCTTGGGTGGGGCCCGG + Intronic
1023221212 7:37921247-37921269 GCGCGGGCATGGGGAGGGCGAGG + Intronic
1023850289 7:44146309-44146331 TTCCGGGCGTGGGCGGGGCCCGG - Intronic
1023883511 7:44334971-44334993 GCCCTGGCAGGAGCCCGGCCAGG - Intergenic
1023984337 7:45086155-45086177 TCCCAGGCAAGGGCCAGGCCCGG + Intronic
1026806679 7:73433639-73433661 GCACGGGGTGGGGCCGGGCCTGG - Intergenic
1026822149 7:73557171-73557193 GCCCCGGGCTGGGCCGGGCGCGG + Intronic
1026941080 7:74288458-74288480 GCCTGGGCATGGACAGGGGCTGG + Intergenic
1026979549 7:74518339-74518361 GCCCGGGGCTGGGCTGGGGCTGG + Intronic
1026994527 7:74606734-74606756 GCCCGGGGGTAGGGCGGGCCGGG + Intergenic
1029115342 7:98233645-98233667 GCCGGGGTGGGGGCCGGGCCGGG + Exonic
1029157268 7:98526126-98526148 GCACAGGCATGGGCTGGGACGGG + Intergenic
1029625918 7:101720181-101720203 GCAGGGGCTTGGGCCGGGCGCGG - Intergenic
1029732667 7:102448070-102448092 GCAAGGTCATTGGCCGGGCCTGG + Exonic
1031604084 7:123748481-123748503 GCCGGGGCCGGGGCCGGGGCTGG + Intronic
1032000007 7:128259161-128259183 GCCCAGGCAGGGGACGGGCCAGG - Intergenic
1032525626 7:132576879-132576901 GCCCGGGCAGCGGCCCGACCGGG - Exonic
1034344732 7:150379307-150379329 CCCCGGGAATGGCCAGGGCCGGG + Intronic
1034345583 7:150383580-150383602 GGCTGGGCATGGGCTGGGACTGG + Intronic
1034445988 7:151114696-151114718 GCCCGGGCCGGGGCCGCGGCCGG - Intronic
1034483613 7:151341990-151342012 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1034561278 7:151880862-151880884 GCCGGGGCAGGGGCTGGGGCTGG + Intergenic
1034971851 7:155424162-155424184 GGTCGGGCATGGGGTGGGCCTGG + Intergenic
1035130862 7:156651906-156651928 GCCCGGGGAGGGGCCGGGGGAGG - Intronic
1035320452 7:158026055-158026077 GGCCCGGCATGGGCCGTGCTTGG - Intronic
1035398241 7:158548965-158548987 GGCCGGGCGTTGGCCGTGCCTGG - Intronic
1035748824 8:1980725-1980747 GCCAGGGCAGGGGCAGGGCAGGG + Intronic
1036548917 8:9799740-9799762 GCCAGGGCAGGGGCCAGGCAAGG + Intergenic
1036648836 8:10629276-10629298 GGCAGGGCATGGGCCCTGCCTGG + Intronic
1036950282 8:13133415-13133437 GCCTGGGAATGGGGCGGGGCCGG - Intronic
1037322250 8:17655142-17655164 GCCCTAGCATGTGCCTGGCCTGG + Intronic
1037926188 8:22845858-22845880 GACCTGGCACGGGCCTGGCCCGG + Intronic
1038472532 8:27837605-27837627 GCCCTGGCGGGGGCCGAGCCCGG - Intronic
1038498269 8:28022780-28022802 ACCCAGGTATGGGCCGGGCACGG + Exonic
1038808001 8:30812485-30812507 GCCCGGGCCGGGGCCGGGGGCGG - Exonic
1039490915 8:37946910-37946932 GCGAGGGCATGGGCAGGGCATGG - Intergenic
1039903035 8:41766907-41766929 GCACGGCCTTGGGCCGGGCGGGG - Intronic
1041201619 8:55455186-55455208 GCGCGCTCATGGCCCGGGCCTGG + Intronic
1041502474 8:58553552-58553574 GCCCGGGCTGGGGCTGGGGCTGG + Intronic
1044698798 8:94948878-94948900 GCGCGGACAAGGGCCCGGCCTGG - Intronic
1045231251 8:100309623-100309645 GCCCGCGCCTGGGCCGGGTAGGG + Intronic
1047292103 8:123540389-123540411 GCCCGTGCCTGGGCAGGGCCTGG + Intronic
1047998622 8:130358732-130358754 GGCGGGGCGGGGGCCGGGCCGGG - Intronic
1048345704 8:133572653-133572675 GCCAGGGCAAGGGCTGGGCCAGG - Intergenic
1049194682 8:141308607-141308629 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1049385905 8:142342872-142342894 GCCCGGGCAGGTGCTGGGACAGG - Intronic
1049385932 8:142343001-142343023 GCCCGGGCAGGTGCTGGGACAGG - Intronic
1049405343 8:142449804-142449826 GCGCGGGCCCGGGCCGGGCCAGG - Exonic
1049415333 8:142492396-142492418 GGCCGTGCATGGGCCGGGAAGGG + Intronic
1049487664 8:142874926-142874948 GCCCGGGCTGGGGAGGGGCCTGG - Intronic
1049620837 8:143597740-143597762 GCGCGGGGCGGGGCCGGGCCGGG + Intronic
1049784508 8:144444119-144444141 GCCCGGGCCCGGGCCGGGATCGG - Intronic
1049788405 8:144462242-144462264 GCCCCGGGCTGGGCCGGGTCGGG + Intronic
1049791833 8:144475772-144475794 GCGTGGGCAGGGGCCTGGCCGGG + Exonic
1049807422 8:144547294-144547316 GCCCGGGCATGGGCAGTGGCAGG + Exonic
1050472323 9:6007113-6007135 GCCCGAGGATGGGCTGGGCCAGG - Intronic
1051170071 9:14313213-14313235 GCCGGGGGGTGGGCAGGGCCGGG - Intronic
1053129107 9:35605382-35605404 GCCTGGGCTTGGGCCTGGACCGG - Exonic
1053691598 9:40589797-40589819 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1053691639 9:40589918-40589940 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1053692416 9:40593029-40593051 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1054272400 9:63044504-63044526 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1054273163 9:63047567-63047589 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1054273204 9:63047688-63047710 GCAAGGGCAGGGGCAGGGCCAGG + Intergenic
1054273281 9:63047952-63047974 ACCCGGGCAGGGCCAGGGCCAGG + Intergenic
1054302895 9:63390884-63390906 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1054303658 9:63393947-63393969 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1054401635 9:64717279-64717301 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1054401676 9:64717400-64717422 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1054402436 9:64720457-64720479 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1054435238 9:65201588-65201610 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1054435279 9:65201709-65201731 GCCGGGGCAGGGCCAGGGCCGGG - Intergenic
1054436046 9:65204788-65204810 GCCAGAGCAAGGGCAGGGCCAGG - Intergenic
1054494346 9:65816899-65816921 GCCAGAGCAAGGGCAGGGCCAGG + Intergenic
1054495111 9:65819972-65819994 GCCGGGGCAGGGCCAGGGCCGGG + Intergenic
1055829154 9:80359493-80359515 GCCGGGGCTGGGGCCGGGGCCGG + Intergenic
1057245469 9:93451501-93451523 GCCCGGAGTTGGGCCGGGACGGG - Intronic
1057478701 9:95426975-95426997 GCCGGGGCAGGAGCCGGGGCAGG - Intergenic
1057758979 9:97857787-97857809 GCTCGCGCACCGGCCGGGCCAGG + Intergenic
1058303004 9:103399098-103399120 GCCAGGGAATGAGCAGGGCCTGG - Intergenic
1058467680 9:105245057-105245079 GCACGGGCATCGGCGGGACCCGG - Intronic
1059769795 9:117414661-117414683 GCCCGCGCCGGGGCCGGGGCTGG - Exonic
1060106438 9:120876319-120876341 GCCCGGCCAGGGGCCAGGCCGGG + Intronic
1060283409 9:122228607-122228629 GCCCGGGCCGGGGTCGGGCAGGG - Intronic
1060812080 9:126615632-126615654 GAGCGGGCGCGGGCCGGGCCCGG - Intronic
1060827139 9:126693817-126693839 GCCGGGGCCGGGGCAGGGCCTGG + Exonic
1060827142 9:126693823-126693845 GCCGGGGCAGGGCCTGGGCCAGG + Exonic
1060855869 9:126914857-126914879 AGCCGGGCCGGGGCCGGGCCAGG - Exonic
1060994289 9:127867501-127867523 GCCCCGGCAAGGGCCAGGCATGG + Exonic
1061162223 9:128902036-128902058 GCCCAGGCACCAGCCGGGCCAGG + Intronic
1061275896 9:129569215-129569237 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1061275902 9:129569227-129569249 GCCGGGGCCGGGGCCAGGCCAGG + Intergenic
1061293709 9:129666161-129666183 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1061559446 9:131393735-131393757 GGAAGGGCATGGGCCCGGCCTGG - Intergenic
1061721035 9:132551584-132551606 ACCCAGGCTTGGGCCGGGCGTGG - Intronic
1061877986 9:133554472-133554494 GCCAGGGCCTGGACGGGGCCGGG + Exonic
1062060340 9:134492102-134492124 GCCCAGGCAAGGGCCAGGCGAGG - Intergenic
1062193142 9:135257821-135257843 CCCAGGGGATGGGCCAGGCCAGG + Intergenic
1062254645 9:135615207-135615229 GCAGGGGCGTGGGCCGGGACAGG - Intergenic
1062379341 9:136279660-136279682 GCCCGGGTATGGGCTGGGATGGG - Intergenic
1062389341 9:136327773-136327795 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1062389345 9:136327779-136327801 GCCGGGGCCGGGGCCGGGGCTGG + Intronic
1062390407 9:136331518-136331540 GCCCAGCCCTGGGCCAGGCCTGG + Intronic
1062418242 9:136464858-136464880 GCTCGGGAGTGGGCCAGGCCTGG - Intronic
1062461981 9:136665995-136666017 GCCCGCGGCTGGGTCGGGCCGGG + Intronic
1062540461 9:137039706-137039728 CCCCGGGGAGGGGCAGGGCCTGG - Exonic
1062570155 9:137181238-137181260 GCCAGGGCAGGGGCCAGGCCTGG + Intronic
1062579573 9:137223327-137223349 GCCTGGGCCTGGGGAGGGCCGGG + Intergenic
1062587298 9:137255160-137255182 GCCCGGGCGCGGGCGGGACCGGG + Exonic
1062614621 9:137390792-137390814 GCCTGGGCAGGCGCCGGGCCAGG + Intronic
1203771913 EBV:53877-53899 GCCCGGGCAGCGGCCGGGAACGG - Intergenic
1203622283 Un_KI270749v1:136006-136028 GCAAGGGCAGGGGCAGGGCCAGG - Intergenic
1185621294 X:1452720-1452742 GCCTGGGCCTGGGCGGGGCAGGG - Intronic
1185640060 X:1585095-1585117 AGCCAGGCATGGGCCGGGCGTGG + Intergenic
1186466238 X:9786350-9786372 GCCGGGGCCGGGGCCGGGGCTGG - Intergenic
1186466242 X:9786356-9786378 GCCGGGGCCGGGGCCGGGGCCGG - Intergenic
1186466431 X:9786954-9786976 CTCCGGGCAGGGGCCTGGCCGGG + Intronic
1186771152 X:12819357-12819379 GCCCAGGCATGGTCTGGGGCAGG - Intronic
1189285016 X:39845799-39845821 CCCCTGCCATGGGCCAGGCCTGG - Intergenic
1189320984 X:40087112-40087134 GGCCGGGCTGGGGCCGGGGCCGG + Intronic
1189337138 X:40176781-40176803 GCTGGGACAAGGGCCGGGCCGGG - Intronic
1189354228 X:40299094-40299116 GCCCGGGCGGGGGCGGGGCGCGG + Intergenic
1189988573 X:46574553-46574575 GCCCGGGCACGGGGTGCGCCAGG - Exonic
1190385632 X:49879956-49879978 GCCGGGGCCGGGGCCGGGGCGGG - Exonic
1190726435 X:53193407-53193429 GAGGGGTCATGGGCCGGGCCAGG - Intronic
1190783982 X:53625844-53625866 GCCGGGGCCAGGGCCGGGGCCGG + Intronic
1190783986 X:53625850-53625872 GCCAGGGCCGGGGCCGGGGCCGG + Intronic
1190783990 X:53625856-53625878 GCCGGGGCCGGGGCCGGGGCCGG + Intronic
1190881470 X:54495423-54495445 GGCCATGCATGGTCCGGGCCTGG + Exonic
1191249444 X:58253483-58253505 GCCAGGGCAAGGGCTAGGCCTGG - Intergenic
1192795215 X:74420671-74420693 GGCCGGGCCAGGGCCGGGCCAGG - Intergenic
1192795220 X:74420682-74420704 GGCCGGGTCTGGGCCGGGCCAGG - Intergenic
1192795228 X:74420698-74420720 GGCCGGGCCAGGGCCGGGCCGGG - Intergenic
1192795234 X:74420709-74420731 GGCCGGGTCTGGGCCGGGCCAGG - Intergenic
1200000376 X:153056810-153056832 GGCTGGGCAGGGGCGGGGCCTGG + Intronic
1200057757 X:153470573-153470595 GCCAGGGCATGGGCGGGGCGCGG - Exonic
1200092929 X:153644253-153644275 CCCCGGGCCTCCGCCGGGCCGGG - Intronic
1200209646 X:154341589-154341611 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1200209650 X:154341595-154341617 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1200209654 X:154341601-154341623 GCCGGGGCCGGGGCCGGGGCCGG + Intergenic
1200209659 X:154341607-154341629 GCCGGGGCCGGGGCCGGGGCGGG + Intergenic
1200221193 X:154390485-154390507 GCCGGGGCCGGGGCCGGGGCGGG - Intronic
1200221198 X:154390491-154390513 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221202 X:154390497-154390519 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221206 X:154390503-154390525 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221210 X:154390509-154390531 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221214 X:154390515-154390537 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221218 X:154390521-154390543 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221222 X:154390527-154390549 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221226 X:154390533-154390555 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1200221230 X:154390539-154390561 GCCGGGGCCGGGGCCGGGGCCGG - Intronic
1201190200 Y:11438176-11438198 GCCAGGGCCTGGGCAGGACCAGG - Intergenic
1201190203 Y:11438182-11438204 GCCCGGGCCAGGGCCTGGGCAGG - Intergenic
1201190208 Y:11438193-11438215 GCCAGGGCAGGGCCCGGGCCAGG - Intergenic
1201337976 Y:12900834-12900856 AGCCGGGCATGGGCCGGGTGCGG - Intergenic
1202583433 Y:26403751-26403773 GCCAGGGCCTGGGCAGGACCAGG + Intergenic