ID: 1202872656

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177975-177997
Sequence CCCGGGCATGGGCCGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872643_1202872656 2 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data
1202872639_1202872656 14 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data
1202872644_1202872656 -5 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data
1202872638_1202872656 15 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872656 Original CRISPR CCCGGGCATGGGCCGGGCCT GGG Intergenic