ID: 1202872656

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177975-177997
Sequence CCCGGGCATGGGCCGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 3, 1: 0, 2: 2, 3: 36, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872638_1202872656 15 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428
1202872643_1202872656 2 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428
1202872639_1202872656 14 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428
1202872644_1202872656 -5 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG 0: 3
1: 0
2: 2
3: 36
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872656 Original CRISPR CCCGGGCATGGGCCGGGCCT GGG Intergenic
900140238 1:1136805-1136827 CCCTGGCACTGGCGGGGCCTGGG + Intergenic
900142957 1:1146151-1146173 CCCTGGCACCGGCCGGGCCCAGG - Intergenic
900346880 1:2214369-2214391 GCAGGGGATGGGCAGGGCCTGGG + Intergenic
900389699 1:2428627-2428649 CCGGCGCAAGGGCCGGGCGTGGG - Intronic
900418565 1:2546016-2546038 CCCGGGCAGGTGCCTGGGCTGGG + Intergenic
900497613 1:2983079-2983101 CCAGGGCCAGGGCCGGGGCTGGG + Intergenic
900527020 1:3134377-3134399 CACGGGCATGGGCTGGGCGGGGG + Intronic
900611022 1:3544721-3544743 CCAGGGCTGGTGCCGGGCCTTGG - Intronic
901401015 1:9015072-9015094 CCCCGGGGTGGGCAGGGCCTGGG + Intronic
901639937 1:10688067-10688089 CCCGGGCCTGGTACGGGCCGGGG - Intronic
901766302 1:11502156-11502178 CCTGGGCCTGGGCCTGGCCTGGG - Intronic
902079475 1:13811480-13811502 CCTGGACAGGGGCCGGGCCTGGG + Intronic
902396528 1:16134999-16135021 CCTGGGCATGGACCAGGCCAGGG - Intronic
902413742 1:16226987-16227009 GTCGGGGTTGGGCCGGGCCTGGG + Intergenic
902448448 1:16482472-16482494 CCAGGGCCTGGGCCTGGCCTGGG - Intergenic
902448646 1:16483594-16483616 CCAGGGCCTGGACCTGGCCTGGG + Intergenic
902506132 1:16939766-16939788 CCAGGGCCTGGACCTGGCCTGGG - Intronic
903216548 1:21846492-21846514 CCTGGGCATGGGCCTGCCCGGGG + Exonic
903228850 1:21909809-21909831 CCCTGGCAAGGGCCTGGGCTAGG + Intronic
903466416 1:23555047-23555069 CCCGGGCTGGGGCAGAGCCTCGG - Intergenic
903554274 1:24181704-24181726 ACCAGGCCTGGGCTGGGCCTGGG - Intronic
903590071 1:24448281-24448303 CCTGGGGCTGGGCCGGACCTTGG + Intronic
903938692 1:26913903-26913925 CCCTGGCATGGGCAGGCCCCTGG + Exonic
904171054 1:28592445-28592467 CCCGGGCAGGGGCGGGGTCGGGG + Intronic
904239419 1:29134380-29134402 CCAGGGGTTGGTCCGGGCCTCGG - Intergenic
904300412 1:29550143-29550165 GCAGGGCATGGGCTGGGCCTGGG + Intergenic
904457808 1:30657915-30657937 GCAGGGCATGGGCTGGGCCTGGG - Intergenic
905462203 1:38129212-38129234 CCTGGGCCTTGGCCGGGCCTGGG - Intergenic
905789823 1:40784043-40784065 CCCGGGCACGGTCCGGGGCGGGG - Exonic
906062537 1:42958186-42958208 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
906153742 1:43602333-43602355 CCGGGGCAGGGGCCAGGCCCTGG - Intronic
906204851 1:43981301-43981323 GGAGGGCATGGGCAGGGCCTCGG - Exonic
906917199 1:50024015-50024037 CCCGGGCCTGAGCTGGGACTTGG + Intergenic
907200954 1:52726535-52726557 TCCGGGCTTGGCCCAGGCCTCGG - Exonic
911176159 1:94820354-94820376 CCGGGGCCGGGGCCGGGGCTGGG - Exonic
913178577 1:116297964-116297986 CCCTGGCATGGCCCTGGCATGGG - Intergenic
915561528 1:156690993-156691015 CCCAGGCCTGTGCCTGGCCTTGG - Intergenic
917231884 1:172846371-172846393 CCCCGGCCATGGCCGGGCCTTGG - Intergenic
918015983 1:180632523-180632545 CCCGGGCCGGGGCCGGGGCCGGG + Intronic
918189912 1:182164070-182164092 CCCTGGCATCGGCAGGGACTGGG - Intergenic
920108280 1:203569714-203569736 CCTGGGCATGGGCTGGGTGTGGG + Intergenic
920850287 1:209623792-209623814 CCCGGGCATGGGCACTGCCGTGG - Intronic
1062874018 10:931292-931314 GCCGGGCCTGGGCCGGGGCCGGG - Intronic
1064418007 10:15167913-15167935 CCCCAGCAGGGGCCGGGCCCGGG + Intronic
1064805258 10:19122984-19123006 CCCAGGCATGGGCTGGCCTTTGG - Intronic
1066321145 10:34305261-34305283 CCCAGGTATGGGCTGGGCCCTGG + Intronic
1069626606 10:69871729-69871751 GACGGGCATGGGGCTGGCCTTGG - Intronic
1069887693 10:71634283-71634305 CCTGGGCTTGGGACAGGCCTGGG + Intronic
1071601168 10:86959362-86959384 CCCGGGCAGGGGCTGGACCCTGG + Intronic
1073045023 10:100632016-100632038 AGGGGGCATTGGCCGGGCCTGGG - Intergenic
1073291398 10:102414968-102414990 CCAGGGAGTGGGCCGGGCCGTGG + Exonic
1073468000 10:103705298-103705320 GGCGGGCGTGGGCCAGGCCTTGG + Intronic
1075090976 10:119444103-119444125 CACGGGCAGGGGCCGGGGCTTGG - Intronic
1075651595 10:124131098-124131120 CCCGGGCCTGGGCTGGACCCTGG - Intergenic
1075885395 10:125895942-125895964 CCCGGGCATGGGCCGGGCCTGGG - Intronic
1076279335 10:129232522-129232544 CCCGGGCAGGGGCAGGGGCAGGG - Intergenic
1076328175 10:129644578-129644600 CCCGTGGAAGGGCCGAGCCTGGG + Intronic
1076785485 10:132747604-132747626 CCCGGGCGCTGGCCGGGGCTCGG - Intronic
1076855901 10:133115526-133115548 GCCAAGCATGGGCCAGGCCTGGG - Intronic
1076905338 10:133358201-133358223 CTTGGGGACGGGCCGGGCCTAGG + Intergenic
1076948204 10:133665677-133665699 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076949193 10:133668987-133669009 CCCCGGTGTGCGCCGGGCCTGGG - Intronic
1076950177 10:133672286-133672308 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076951162 10:133675585-133675607 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076952152 10:133678895-133678917 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076953140 10:133682205-133682227 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076955108 10:133741856-133741878 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076956098 10:133745166-133745188 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076957086 10:133748475-133748497 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076958075 10:133751785-133751807 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076959059 10:133755084-133755106 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076960048 10:133758394-133758416 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1077101577 11:824825-824847 CCCGATCACGGGCCGGGCCTCGG - Exonic
1077217301 11:1400300-1400322 CCCGGGCATGGGGTGGGCCTGGG + Intronic
1077360422 11:2138189-2138211 GCCGGGCCGGGGCCGGGGCTGGG - Intronic
1077495498 11:2884871-2884893 CCGGGGCCGGGGCCGGGGCTGGG + Exonic
1077609588 11:3636114-3636136 CCAGGGCAGGGGCTGTGCCTGGG + Intergenic
1077610745 11:3642002-3642024 GCGGGGCGTGGGCGGGGCCTGGG + Exonic
1079122517 11:17695908-17695930 CCGGGGCCGGGGCCGGGCCGGGG + Intergenic
1080827793 11:35862373-35862395 CCTGGGCCTGGGCCTGGGCTTGG - Intergenic
1080836261 11:35943958-35943980 GCCGGGCCGGGGCCGGGCCCGGG + Intergenic
1081617342 11:44598773-44598795 CCCGAGCCTGGGGCTGGCCTGGG - Intronic
1081636787 11:44727068-44727090 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1082050438 11:47766863-47766885 CTCGGGCTTGGCCCGGGCCGAGG + Intronic
1083303768 11:61752573-61752595 GGCGGGCAGGGGCCGGGCCAGGG + Intergenic
1083967522 11:66051838-66051860 TCCGGGCCTGGGCCGGGGGTGGG + Intronic
1084156764 11:67317500-67317522 CCCAGGCTGGGGCGGGGCCTCGG + Intergenic
1084165578 11:67373414-67373436 CCCGCGCCGGGGCCGGGCCAGGG - Intronic
1084556678 11:69879886-69879908 CCCAGGAAGGGGCCAGGCCTGGG - Intergenic
1084575666 11:69986416-69986438 CCCGGGGCTGGGCTGGGGCTGGG + Intergenic
1084682348 11:70673728-70673750 CTCCGGCATGGGCCTGGCCTGGG - Intronic
1085048541 11:73367630-73367652 GCCTGGCAGGGGCGGGGCCTCGG - Exonic
1085741143 11:79079376-79079398 GCTGGGCATGTGCAGGGCCTAGG + Intronic
1088064146 11:105695354-105695376 CCAGGCCATGGGCCTGGCCATGG - Intronic
1088579353 11:111300112-111300134 CCTGGGGAGGGGCCAGGCCTGGG - Intronic
1089533850 11:119149212-119149234 CCCGGGCCGGGGCGGGGCCGGGG - Exonic
1089616383 11:119697038-119697060 AGCGGGCAGAGGCCGGGCCTGGG + Intronic
1089734446 11:120540015-120540037 CCTGGGCTGGGGCTGGGCCTAGG + Intronic
1090178602 11:124673752-124673774 TCCCGGCAGGGGCGGGGCCTGGG + Exonic
1090385490 11:126355705-126355727 CCCGGGCGCGGGTCCGGCCTGGG - Intronic
1090646587 11:128771332-128771354 CTCGTGCATGGGCAGGGCCTGGG + Intronic
1090657953 11:128860114-128860136 ACCGGGCAGGAGCCAGGCCTCGG + Intronic
1090792746 11:130105990-130106012 CACAGGCATCGGCCGGGCGTGGG - Intronic
1091730531 12:2877093-2877115 CCCGGGCCGGGGCCGGGGGTGGG + Intronic
1091915356 12:4269281-4269303 GCCGGGCAGGGTCCGGGCCCTGG - Intergenic
1096139928 12:49234520-49234542 CCAGGGCCTGGGCCTGGGCTCGG + Intronic
1096618716 12:52849029-52849051 CCCGTACCTGGGCTGGGCCTTGG + Intronic
1096692663 12:53330616-53330638 CGAGGCCATGGGCAGGGCCTTGG + Intronic
1101904094 12:108812508-108812530 CCCTGGCCTAGGCCTGGCCTTGG - Intronic
1102520083 12:113472486-113472508 CCTGGGCCTGGGCCTGGGCTCGG - Intergenic
1103359090 12:120342961-120342983 GCAGGGCAGGGGCCGGGCCCGGG + Exonic
1103477698 12:121230724-121230746 CCACGCCATGGGCCAGGCCTGGG - Intronic
1103552788 12:121748467-121748489 CCTGGGCATGGGCCTGTGCTAGG - Intronic
1103557538 12:121775425-121775447 CTCAGGCTTGGGCAGGGCCTGGG - Intronic
1104376254 12:128267317-128267339 CCCGGGCATGGGGCGGCCGGCGG + Intergenic
1104726149 12:131076920-131076942 GGCTGGCATGGGGCGGGCCTGGG - Intronic
1104856237 12:131903722-131903744 GCTGAGCATGGGCCAGGCCTTGG + Intronic
1104899324 12:132179867-132179889 CCCTGGCACAGGCAGGGCCTGGG + Intergenic
1107133579 13:36920535-36920557 GCCGGGCAGGGGCCGAGCCTGGG - Intronic
1113769230 13:112897978-112898000 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1113805973 13:113110184-113110206 GCCGGGCAGGGGCCGCGCCTCGG + Intronic
1113851422 13:113420866-113420888 CCCGGGGGTGGGCGGGTCCTGGG - Intergenic
1113874401 13:113585156-113585178 CCGGGGCCGGGGCCGGGGCTGGG + Intronic
1114452541 14:22836758-22836780 CCAGGGCGTGGGCCCGGCCGCGG + Exonic
1114484657 14:23055638-23055660 CCCGGGCCTGGGCAGGGTCCCGG - Exonic
1116861816 14:50001442-50001464 CCGGGGCATGGGCAGGGGCCAGG - Intronic
1117066094 14:52014413-52014435 CCGGGGCGTGGGCCGGACCATGG + Exonic
1118766858 14:68915686-68915708 CCAGGGCAGGGCCCAGGCCTGGG + Intronic
1119286392 14:73458357-73458379 CCCGGGCCGGGGCCGGGGCCAGG - Intronic
1119544933 14:75464766-75464788 CCCGGGGAAGGGGCAGGCCTTGG + Intronic
1119743519 14:77028508-77028530 CCCGGGCGCCGGCCAGGCCTGGG - Exonic
1119781662 14:77280107-77280129 GCCGAGGATGGGCTGGGCCTGGG - Intronic
1120786791 14:88545433-88545455 CCTGGGCATGGGCACTGCCTGGG - Intronic
1121456770 14:94043395-94043417 CCCAGGCCTGGGCCTGGCCCTGG - Intronic
1121473428 14:94174192-94174214 CCCGGGAAGGGGCGGGGCCGAGG + Intronic
1121853936 14:97249144-97249166 ACTGGGCCTGGGCCTGGCCTTGG + Intergenic
1122645100 14:103189072-103189094 CCCGGGCGTGGCGAGGGCCTCGG - Intergenic
1122922746 14:104886685-104886707 CCAGGGGATGGGGAGGGCCTAGG + Exonic
1123084875 14:105712767-105712789 GCAGGGCCTGGGCCGGGCCAGGG - Intergenic
1202872656 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG + Intergenic
1124629025 15:31326800-31326822 CCCGGGGGTGGGCGGGGCCGGGG - Intergenic
1125709020 15:41768691-41768713 CCAGTGCCTGGGCCGTGCCTAGG + Exonic
1126348269 15:47718464-47718486 TCCGGGCCTGGGCCGGGGATGGG - Intronic
1126705527 15:51401920-51401942 CCCAGGCAGGGGCTGGGCCATGG - Intronic
1126827759 15:52568804-52568826 CCCGGCCTTGGGCAGGGCCCAGG + Intronic
1127071339 15:55290299-55290321 CCGGGGGCAGGGCCGGGCCTGGG - Intronic
1128245714 15:66131315-66131337 CCCGGGCCTGGGCCGTGCTGTGG + Intronic
1128731844 15:70026581-70026603 CCTGGCCATAGGCTGGGCCTGGG - Intergenic
1128758826 15:70201080-70201102 CCCTGGCATCTGCCGAGCCTGGG + Intergenic
1132572387 16:649685-649707 TGCGGGGCTGGGCCGGGCCTCGG - Intronic
1132609349 16:807532-807554 CGCGTGCAGGCGCCGGGCCTGGG + Exonic
1132681925 16:1145954-1145976 CCCGGGGCTGGGCCTGGGCTGGG + Intergenic
1132748662 16:1447374-1447396 CCCAGGCATGTGCAGGGCATGGG - Exonic
1132755658 16:1483535-1483557 CCTAGACATGGGCCGGGCCTTGG + Intergenic
1132827784 16:1913678-1913700 TCCTGGCAGGGGCCGGTCCTGGG - Intronic
1132844187 16:1992426-1992448 CCCGGGTCTGGGCGGAGCCTGGG + Intronic
1133170268 16:3978598-3978620 CCCGGGCAGTGGCCGGGCTGGGG - Intronic
1133229295 16:4359169-4359191 CCTGGGCTGGGGCTGGGCCTGGG - Intronic
1133311288 16:4848066-4848088 CCCGGCCATGGGCCGAGGCGCGG + Intronic
1133784264 16:8963082-8963104 CCCGGGCGGCCGCCGGGCCTCGG - Intronic
1136116300 16:28097093-28097115 CCTGGGCAGGGGCTGGGCCGGGG - Intergenic
1136453891 16:30369937-30369959 CCGGGGCTGGGGCCGGGGCTGGG + Exonic
1136538310 16:30913456-30913478 CCGAGGCATGGGCCGTGCCATGG + Intergenic
1136561078 16:31039660-31039682 CTGGGGCAGTGGCCGGGCCTGGG - Intronic
1137531617 16:49281910-49281932 CCGGGGCGGGGGCAGGGCCTCGG - Intergenic
1138554503 16:57763771-57763793 CGCTGCCTTGGGCCGGGCCTGGG - Intronic
1139472504 16:67185630-67185652 CCCAGGCATGGACCAGGGCTGGG + Intronic
1139485745 16:67255701-67255723 CCCGGGTAGGGTCCGGGCCAGGG + Intronic
1139594008 16:67947839-67947861 CCAGGGCATGGGCCAGGCTGTGG - Intronic
1139776249 16:69318782-69318804 CCCGGGCCCGGGCCCGGCCAAGG - Intronic
1140884437 16:79230436-79230458 CCCGGGCAAGGGCAGGGTCTAGG - Intergenic
1141623929 16:85251581-85251603 CCTGGGCAGGGGCTGGGCCCGGG + Intergenic
1141897129 16:86965224-86965246 CCCGAGCACGGGCTGGGGCTGGG - Intergenic
1142009727 16:87707727-87707749 CCCGGGCCAGGGCTGGGCCTAGG - Intronic
1142044779 16:87918606-87918628 CCACGGCATGGCCCAGGCCTCGG + Intronic
1142134400 16:88444949-88444971 CCCTGCCATGCCCCGGGCCTTGG - Intergenic
1143331478 17:6139290-6139312 ACCTGGCATGGGCCAGGCCCAGG - Intergenic
1143762848 17:9117309-9117331 CCCAGGGAAGGGCCCGGCCTGGG + Intronic
1144659028 17:17056449-17056471 CAGGGGCAGGGGCCGGGGCTGGG + Intronic
1144874291 17:18389153-18389175 CCTGGGCATGGAGCGAGCCTTGG + Exonic
1145157936 17:20555265-20555287 CCTGGGCATGGAGCGAGCCTTGG - Intergenic
1145840020 17:27986931-27986953 CACAGGCGTGGGCAGGGCCTGGG - Intergenic
1146467251 17:33095927-33095949 CCCAGGCATGGGGAGGGGCTTGG + Intronic
1147139651 17:38453936-38453958 CCGGGGCAGTGGCCGGGCCCGGG + Intronic
1147383308 17:40068357-40068379 CCCTGGCATGTGCCAGGCCCTGG - Intronic
1147440370 17:40443775-40443797 GCCGGGCCCGGGCCGAGCCTGGG + Exonic
1148107778 17:45128444-45128466 CCCTGGCAGGTGCCTGGCCTGGG - Intronic
1148344604 17:46894941-46894963 CCCGGGCAGGGGCCTGTGCTCGG + Intergenic
1148870552 17:50656755-50656777 CCCGGCCATGGACCAGGCCATGG - Exonic
1148930083 17:51120764-51120786 CCCGGGCCGGGGCTGGGGCTGGG + Exonic
1150249743 17:63699206-63699228 CCCGGACAGGAGCCTGGCCTGGG - Intronic
1150488759 17:65560868-65560890 CCCTGGCAGGGGCCCGGCCCCGG + Intronic
1150791881 17:68205737-68205759 CCGGGGCAGGGGCCGGGGCAGGG - Intergenic
1151443756 17:74150179-74150201 CCCAGGCAGGGGCCTTGCCTGGG - Intergenic
1151565221 17:74893768-74893790 CGCGCGCCTGAGCCGGGCCTGGG - Intronic
1151724940 17:75878263-75878285 CCAGGGCAGGGGCCGGGCCGGGG + Exonic
1151828293 17:76535723-76535745 CCCAGACATGGCCCTGGCCTCGG + Intronic
1151852321 17:76698256-76698278 CCCCAGAATGGGCCGGGCCCAGG + Intronic
1152034226 17:77862121-77862143 CCAGGGCCTGGGCCGGGACCTGG - Intergenic
1152381540 17:79944881-79944903 CCAGGGCAGGGGCCAGGGCTGGG - Intronic
1152786089 17:82248838-82248860 CCCGGGCGGGCGCTGGGCCTCGG - Intronic
1153688503 18:7568306-7568328 CCCGAGCAGCGGCCGGGCCCAGG + Intronic
1154255536 18:12777979-12778001 CCTGGGGCTGGGCCGGGGCTTGG - Intergenic
1154980643 18:21499959-21499981 CCCGGCCATGGGAGGGTCCTGGG - Exonic
1156290895 18:35747913-35747935 CCCAGGCTTGAGCTGGGCCTGGG - Intergenic
1156479265 18:37426042-37426064 CCAGGGCAAGGGCTGGGGCTGGG - Intronic
1158554190 18:58461592-58461614 CTGGGGCATGGCCCAGGCCTTGG - Intergenic
1160228172 18:77027445-77027467 CCTGGGCAGGGGCAGGGCCAGGG + Intronic
1160242516 18:77133283-77133305 GCCGGACATGGGCCTGGCCTGGG - Intronic
1160543414 18:79637945-79637967 CCCGGGCCCAGGCCGTGCCTCGG - Intergenic
1160726147 19:618670-618692 CCCGGGCTGGGGCCTGGCCGGGG - Intronic
1160738096 19:673935-673957 CCCAGGCCTGACCCGGGCCTGGG - Intergenic
1160781140 19:878429-878451 CCGGGGCCGGGGCCGGGGCTGGG - Intronic
1160788768 19:913234-913256 GGCGGGCAGGGGCGGGGCCTGGG + Intronic
1161030115 19:2054115-2054137 CCCAGGCATGGGCTGAGCCTTGG - Intergenic
1161031792 19:2061139-2061161 CCTGGGCATGGGGCCGGCCCAGG + Intergenic
1161170152 19:2808456-2808478 CCCGGGCAGGGGCAGGGGCAGGG + Intronic
1161236550 19:3201221-3201243 CCCGGGCGCGGGCCGAGCCGAGG + Intronic
1161681294 19:5681085-5681107 CCCGGGGAGGGGCCGGGCCTCGG - Exonic
1161726707 19:5933516-5933538 CCTGGGCTGGGGCTGGGCCTGGG + Intronic
1162123433 19:8486207-8486229 CCCTGCCATGGGCCCGGCCCTGG + Exonic
1162159130 19:8698628-8698650 CTGGGGTTTGGGCCGGGCCTGGG + Exonic
1163018453 19:14470691-14470713 CCCCGACGTGGGGCGGGCCTGGG + Intronic
1163168188 19:15511877-15511899 CCTGGGCGTGGGCCGGGACACGG + Intronic
1163547229 19:17947796-17947818 CCGGGGCCGGGGCCGGGGCTAGG - Intergenic
1163578308 19:18123394-18123416 CCCAGGGAGGGGCCGGGGCTGGG - Intronic
1163598337 19:18233266-18233288 CCCGGCCCTGGGCCGGACCCGGG - Exonic
1163666678 19:18606853-18606875 CCCGGGGCCGGGCCGGGCCGGGG - Intronic
1165144165 19:33720941-33720963 CCCTGGCTTGGGCCAGGTCTGGG - Intronic
1166689314 19:44813217-44813239 CACGGGCATGGCCCTGGGCTTGG - Intronic
1167298794 19:48667414-48667436 CCTGGGCCTGGACAGGGCCTGGG - Intronic
1168153523 19:54461276-54461298 CCCCGGCATGGGATGGGCCAGGG - Exonic
1168316472 19:55486781-55486803 CCCGGGCTCGGGCCTGGGCTGGG + Exonic
1168340770 19:55621875-55621897 CACGGGCCGGGGCCGGGGCTGGG - Exonic
925425531 2:3746347-3746369 CCCTGGCCAGGGCCTGGCCTAGG - Intronic
929788745 2:45009328-45009350 CCCGGGCTTGGGCGAGGGCTTGG - Exonic
931249934 2:60521356-60521378 CCCGGGCCTGGGCCTGGGCCTGG + Intronic
931456215 2:62411614-62411636 CCAGGGAAGGGGCAGGGCCTCGG - Intergenic
931640784 2:64379377-64379399 GCCTGGCATGGGCCGTGCCCTGG + Intergenic
932463312 2:71897274-71897296 CCAGGGCCTGGGCCTGCCCTTGG - Intergenic
932621774 2:73269086-73269108 CCGGGGCAAGGGCCGGGGCCGGG + Exonic
934322973 2:91983902-91983924 CCAGGGCAGGGGCAGGGCCATGG - Intergenic
934761411 2:96858928-96858950 TCAGGGCAGGGGCAGGGCCTTGG + Intergenic
935619779 2:105119022-105119044 CCAGGGCATGGGCGGAGCCCTGG + Intergenic
935692577 2:105744759-105744781 CCCGGGCCTGGGCCGGCCCCTGG + Intergenic
937924134 2:127154573-127154595 CCCCGGCATAGGGCAGGCCTGGG + Intergenic
945245241 2:207711692-207711714 CCCGGGCAGGGCTCGGGCCTCGG - Intronic
947860391 2:233354087-233354109 CCCGGTACTGGGACGGGCCTCGG - Intergenic
948305599 2:236944803-236944825 CCCGGGTGTGGGCTGGGACTGGG - Intergenic
948393337 2:237627568-237627590 CCGGGGCCGGGGCCGGGCCGGGG + Intronic
948697284 2:239738162-239738184 CCGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697365 2:239738313-239738335 CCGGGGCTGGGGCCGGGGCTGGG - Intergenic
948697373 2:239738325-239738347 GCTGGGCCTGGGCCGGGGCTGGG - Intergenic
948772634 2:240259324-240259346 CCCTGGCATGGGCCTGGGCCAGG - Intergenic
949019877 2:241735001-241735023 CCCGGGCAGGGGGAGGGCCCGGG + Intronic
1170629939 20:18057507-18057529 CGCGCGCGGGGGCCGGGCCTGGG - Intronic
1171255211 20:23685278-23685300 CACAGGCAGGGGCCAGGCCTCGG - Intergenic
1172443197 20:34979811-34979833 CCCGCCCATGGCCCGGGCCTGGG - Intronic
1172625567 20:36344729-36344751 CCTGGGCCTCGGCTGGGCCTAGG + Intronic
1172764411 20:37343670-37343692 GCTGGGCATGGGCCAGGCCTTGG + Intergenic
1172775672 20:37405292-37405314 CCTGGCTCTGGGCCGGGCCTGGG + Exonic
1173589114 20:44210553-44210575 CTCCTGCCTGGGCCGGGCCTGGG - Intronic
1174914830 20:54643601-54643623 CCAGGGTGTGGGCCAGGCCTGGG + Intronic
1175403211 20:58712215-58712237 CCTGGGCATGGGCTGGGCTGTGG - Intronic
1175847191 20:62065269-62065291 CCGGGGCCGGGGCCGGGCCCGGG + Exonic
1176009505 20:62885224-62885246 CACAGGCATGGGCTAGGCCTCGG + Intronic
1176101568 20:63366813-63366835 CCCGGTCAAGGTCGGGGCCTGGG + Intronic
1176140614 20:63543181-63543203 CCCAGGCCTGGGCAGGGCCCTGG + Intronic
1176555725 21:8253304-8253326 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1176574662 21:8436338-8436360 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1176611275 21:8987630-8987652 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1178948397 21:36966688-36966710 GCCGGGGCGGGGCCGGGCCTGGG - Intronic
1179908804 21:44437420-44437442 CCCAGGCATGGGCTGGGCTGCGG + Intronic
1180064281 21:45405031-45405053 GCCGGGCAGGGGCCGGGCAGGGG - Intergenic
1180064313 21:45405092-45405114 GCCGGGCAGGGGCCGGGCAGGGG - Intergenic
1180197292 21:46205405-46205427 CCCCGTCATGGGGCGGGCCGAGG + Intronic
1180285439 22:10741501-10741523 CCCGGGCATGGGCCGGGCCTGGG - Intergenic
1180843602 22:18970358-18970380 CGCGGGCCTGGGCGGGGGCTGGG - Intergenic
1181407143 22:22692989-22693011 CCTGGCGATGGGGCGGGCCTGGG + Intergenic
1181415129 22:22753763-22753785 CCTGGGGATGGGGCAGGCCTGGG + Intronic
1183093965 22:35541243-35541265 CCCGGGCAGGGGGCGGGCTCCGG - Exonic
1183273201 22:36874754-36874776 CCCGGCCATGGCCTGGGCTTTGG - Intronic
1183650831 22:39152466-39152488 CCCGGGGCCGGGCCGGGCCGGGG + Exonic
1184313547 22:43664792-43664814 CCAGGGCCTGAGCCTGGCCTAGG - Intronic
1184439200 22:44498241-44498263 CCGGGGCAGGGGCGGGGCCGGGG + Exonic
1184585997 22:45448602-45448624 CCAGGCCACCGGCCGGGCCTGGG - Intergenic
1184644302 22:45888017-45888039 CCCGGGCCTTGGCCAGGACTGGG - Intergenic
1184674763 22:46035786-46035808 GCGGGGCTTGGGCGGGGCCTGGG - Intergenic
1184697987 22:46150440-46150462 CCGGGGCAGGGGGCGGGCCGAGG + Intergenic
1184718774 22:46297022-46297044 CCCCGCCAGGAGCCGGGCCTGGG + Intronic
1184760053 22:46538623-46538645 CCCCCGCATGGGCGGGGCTTTGG + Intergenic
1185321290 22:50201251-50201273 CCCGGGCACGGGCCGCGGCGCGG - Exonic
1185384636 22:50526171-50526193 CTCGGGAAGGGGCGGGGCCTCGG + Intronic
1203252709 22_KI270733v1_random:125388-125410 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1203260766 22_KI270733v1_random:170475-170497 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
950021338 3:9789821-9789843 GCAGGACATGGGCCGGGCCCTGG - Exonic
950111374 3:10420910-10420932 CTGGGGCATGGCCCGGACCTTGG + Intronic
950262448 3:11552943-11552965 CTCGGGCCTGGGCCGGGGCTGGG - Intronic
950443535 3:13023327-13023349 GCCTGGCCTGGGCTGGGCCTGGG - Intronic
950479927 3:13237887-13237909 CCCAGGCAGGGGGCGGGCCGAGG + Intergenic
950658729 3:14453388-14453410 GCCGGGCATGGTGCTGGCCTTGG - Intronic
950702154 3:14758074-14758096 GCTGGGCATGGACCGGGCCCTGG + Intronic
951217739 3:20040524-20040546 CCGGGGCAGGGGCCGGGCCCGGG + Exonic
953901422 3:46846068-46846090 CCGGGGCCTGGGCCGGGGCCGGG - Intergenic
954278011 3:49554801-49554823 CCCGGGCCAGGGCCGGGACCGGG - Exonic
954361318 3:50124292-50124314 CCGGGGCCTGGGCCGGGGCCAGG - Intergenic
954535751 3:51358174-51358196 CCTGGGCAGGGGCCGGGGTTGGG + Intronic
954882625 3:53846140-53846162 GCGGGGCAGGGGCCGGGCCGCGG - Exonic
958900102 3:99876091-99876113 GCCGGGCGGGGGCCGGGCCGGGG + Intronic
960925980 3:122795241-122795263 CCCGGGCTCGGGCCTGGGCTGGG + Exonic
960989273 3:123300325-123300347 CCCGGGGTCGGGCAGGGCCTGGG - Intronic
961551556 3:127672866-127672888 CCGGGGCAGGGGCGGGGCCGCGG + Intergenic
961599878 3:128052375-128052397 GCGGGGCCGGGGCCGGGCCTCGG - Exonic
964379848 3:156087397-156087419 CTCAGGCATGGGCATGGCCTCGG + Intronic
967015558 3:185478558-185478580 CCTGGGCATCAGCCAGGCCTAGG + Intronic
967207816 3:187139544-187139566 CCCGGGCCTGGGCGGGGCCGGGG - Intronic
967840893 3:194003708-194003730 CCTGGGCCTGGGTTGGGCCTGGG + Intergenic
967867748 3:194204195-194204217 CCCGGGCCCGGGCCGCGTCTCGG - Intergenic
968074579 3:195809462-195809484 ACCGGGCATGACCAGGGCCTTGG - Intronic
968313685 3:197704573-197704595 CCCGAGCAGGGGCCGGAGCTGGG + Exonic
968569333 4:1331325-1331347 CCAGGGCCTGTGCAGGGCCTGGG - Intronic
968578525 4:1379022-1379044 CCCTAGCGTGGGCCGTGCCTGGG + Intronic
968578877 4:1380512-1380534 CCCGGGTCTGTGCTGGGCCTGGG + Intronic
968629115 4:1641186-1641208 CCAGGGCAGGTGCCGGGCCGTGG + Exonic
968641655 4:1717833-1717855 CCTGGGCACGGGACGGACCTAGG + Intronic
968724940 4:2242353-2242375 CCTGGACAGGGGCGGGGCCTGGG + Intergenic
968843968 4:3029530-3029552 CAGGGGCAGGGGCAGGGCCTGGG - Intronic
968905718 4:3449715-3449737 CCCCGGCCTGGGGCTGGCCTGGG - Intergenic
969244908 4:5925692-5925714 CCCAGACATGGCCCTGGCCTTGG + Intronic
979087176 4:116428144-116428166 CCTGGGCCTGGGCCTGGCCCAGG - Intergenic
980405068 4:132344906-132344928 CCGGGGCTGGGGCCGGGGCTGGG + Intergenic
980727815 4:136787726-136787748 CCCAGGAATGGGCTGGGCCCAGG + Intergenic
984908246 4:184649300-184649322 CCCGGGCGGGCGCAGGGCCTGGG + Intronic
985452648 4:190069777-190069799 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985453634 4:190073074-190073096 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985454624 4:190076367-190076389 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985455612 4:190079660-190079682 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985456596 4:190082954-190082976 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985457584 4:190086254-190086276 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985458571 4:190089547-190089569 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985459560 4:190092847-190092869 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985565368 5:612623-612645 CGCGGGCAGGGGCCGCACCTGGG - Intronic
985732280 5:1556090-1556112 CCCGGACATGGGGTGGACCTAGG - Intergenic
986695944 5:10354136-10354158 GCCGGGCAGGGGCCGGGGCCGGG + Intronic
987374226 5:17218588-17218610 CCCGGGCCCGGGCCGGGGCCGGG - Intronic
989369597 5:40692165-40692187 GCCTGGCATGGGCCTGGCCCAGG + Exonic
989478786 5:41904285-41904307 CCCCGGCACGGGCGGGGCCTAGG - Intronic
996058911 5:119011311-119011333 CCTGGGCTGGGGCCGGGGCTGGG + Intergenic
997568204 5:134905319-134905341 ACCCGGCGTGGGCCGAGCCTTGG + Intronic
997899763 5:137754069-137754091 CGGGGGCAAGGCCCGGGCCTTGG - Exonic
998835776 5:146201805-146201827 ACCGGGCATGGGACGGGCGTGGG - Intergenic
998839021 5:146233608-146233630 CCCGGGCCTGGGCCTGGACCTGG - Exonic
998839033 5:146233632-146233654 CCCGGGCCTGGGCCTGGACCTGG - Exonic
999153726 5:149443088-149443110 CAGGGGCATGGGCTGGTCCTAGG + Intergenic
999637541 5:153638528-153638550 CTTGGGCATGGGCCGCCCCTGGG - Intronic
1001382115 5:171311812-171311834 CCCGGGCCTGGGGCGGGACGGGG - Exonic
1001677705 5:173532199-173532221 CCTGGGCATGGCCTGAGCCTGGG - Intergenic
1002025304 5:176392730-176392752 ACAGAGCATGGGCTGGGCCTGGG - Exonic
1002060028 5:176620603-176620625 CCGGGGCATGGACAGGGCCAGGG - Exonic
1002181307 5:177432484-177432506 CCAGGGTATGGGCTGGGCTTGGG + Intronic
1002871373 6:1169921-1169943 CCCTGGCCTGGGAGGGGCCTGGG + Intergenic
1003086988 6:3068453-3068475 CCCCGGCAAGGGCCGGGGCAGGG + Exonic
1003218432 6:4135777-4135799 CTGGGGCATGGGCGGGGCCAGGG + Intergenic
1006645389 6:35511750-35511772 CCCGGGCCTGGGCTGGGTCTGGG + Exonic
1006790538 6:36698367-36698389 ACCTGGCATGGGCCCTGCCTGGG - Intronic
1007614418 6:43171789-43171811 CCCGGGAATGGCGCGGGGCTCGG + Exonic
1007702001 6:43771114-43771136 CCAGGCCCTGGCCCGGGCCTCGG + Exonic
1007702794 6:43774295-43774317 CATGGGCATGGGCAGGGGCTGGG - Intronic
1007820272 6:44555787-44555809 TCCTGGCATGGGCTGGGTCTGGG - Intergenic
1007967514 6:46015949-46015971 CTCGGGCCTGGGCCGGGCCACGG + Intronic
1011044671 6:83068007-83068029 CCGGGGCCTGGGCCGGGCAGAGG + Intronic
1011113064 6:83859752-83859774 CCCGGGCAGGGCCCGGGGCCGGG + Exonic
1011607266 6:89117730-89117752 CCCGAGCCTCCGCCGGGCCTCGG + Intronic
1014477245 6:121888748-121888770 ACAGGGCATGGGGCGGGCGTGGG - Intergenic
1015244791 6:131063378-131063400 CCCGCGCAGGGGCGGGGCCTGGG - Intergenic
1016400833 6:143678157-143678179 CCCAGTCATGGGCCAGACCTCGG + Exonic
1019138417 6:169927152-169927174 CCCTGGCAGGGGCCGGGCTGAGG + Intergenic
1019148764 6:169990675-169990697 CCCAGGCATTGGCCCTGCCTGGG + Intergenic
1019303658 7:322292-322314 GCCAGGGATGGGCCGGGCCGCGG + Intergenic
1019349014 7:544500-544522 CCCAGGCAAGGGCTGGGTCTGGG - Intergenic
1019379148 7:712288-712310 CGCGGGGCGGGGCCGGGCCTGGG - Intronic
1019523444 7:1470527-1470549 CCCGGGGACGGGACGGGCCGGGG + Exonic
1019587962 7:1815063-1815085 CCCGGGCGTGGCCCTGGCCCAGG + Intergenic
1019599674 7:1874948-1874970 CCCGGGCCCCGGCTGGGCCTGGG + Intronic
1019601999 7:1889453-1889475 CCCTGGGCTGGGCCTGGCCTAGG - Intronic
1019616647 7:1965966-1965988 CCCAGGCATGGGCCGACCCAGGG - Intronic
1019719428 7:2559297-2559319 CCCGCGCAGGGGCCGGCCCGGGG + Intronic
1019926515 7:4196608-4196630 CCCGGGCAGTGCCTGGGCCTAGG - Intronic
1020106541 7:5424708-5424730 CCCGGGCCTGGGCCGAGCGGGGG - Intronic
1023795310 7:43787556-43787578 CCAGGCCATGGGCTGGGTCTGGG + Intronic
1023850288 7:44146308-44146330 TCCGGGCGTGGGCGGGGCCCGGG - Intronic
1023984338 7:45086156-45086178 CCCGGGCCTGGCCCTTGCCTGGG - Intronic
1023984339 7:45086156-45086178 CCCAGGCAAGGGCCAGGCCCGGG + Intronic
1024094629 7:45974032-45974054 CCTGGGCGTGGGTCTGGCCTTGG + Intergenic
1026941082 7:74288459-74288481 CCTGGGCATGGACAGGGGCTGGG + Intergenic
1026979551 7:74518340-74518362 CCCGGGGCTGGGCTGGGGCTGGG + Intronic
1028477494 7:91266828-91266850 CCTGGGCATGGGCTGAGCCCCGG - Exonic
1029448794 7:100629218-100629240 CCAGGGCCTGGGCCTGGGCTAGG - Intronic
1032693889 7:134316736-134316758 ACCGGCCATGCGCCCGGCCTTGG - Exonic
1033165594 7:139036106-139036128 CCCGGGGATGGGCCTGGGCCTGG + Intergenic
1034969933 7:155412669-155412691 CCAGGGCCGGGGCAGGGCCTGGG - Intergenic
1034971852 7:155424163-155424185 GTCGGGCATGGGGTGGGCCTGGG + Intergenic
1035352230 7:158254945-158254967 CCTGGGCCTGGGCCATGCCTCGG - Intronic
1035398240 7:158548964-158548986 GCCGGGCGTTGGCCGTGCCTGGG - Intronic
1035447315 7:158951832-158951854 CCAGGGCAAAGGCCAGGCCTTGG - Intronic
1036648837 8:10629277-10629299 GCAGGGCATGGGCCCTGCCTGGG + Intronic
1039484388 8:37899567-37899589 CTCGGGCAGGGGCGTGGCCTTGG - Intergenic
1039490914 8:37946909-37946931 CGAGGGCATGGGCAGGGCATGGG - Intergenic
1039608486 8:38901420-38901442 CCCGTGCAGGGGCCGGGGCTCGG - Exonic
1039953606 8:42190956-42190978 CCAGAGCATGGGCCTGGCCTCGG + Intronic
1041502476 8:58553553-58553575 CCCGGGCTGGGGCTGGGGCTGGG + Intronic
1042040076 8:64580907-64580929 CCCGGGCATGGACCTGTCCCTGG + Exonic
1048345702 8:133572652-133572674 CCAGGGCAAGGGCTGGGCCAGGG - Intergenic
1049377099 8:142294483-142294505 ACCGGGCATGGTTCTGGCCTGGG + Intronic
1049487662 8:142874925-142874947 CCCGGGCTGGGGAGGGGCCTGGG - Intronic
1049668521 8:143859345-143859367 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049668937 8:143860947-143860969 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049669352 8:143862549-143862571 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049669764 8:143864142-143864164 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049670179 8:143865750-143865772 CCCGGGCCTGGGCCTGGGCCTGG + Exonic
1049709971 8:144059062-144059084 CTCAGGCATGGGCACGGCCTGGG + Exonic
1049807424 8:144547295-144547317 CCCGGGCATGGGCAGTGGCAGGG + Exonic
1050472321 9:6007112-6007134 CCCGAGGATGGGCTGGGCCAGGG - Intronic
1051629368 9:19127726-19127748 GCCGGGCGGGGGCCCGGCCTGGG + Intronic
1054273283 9:63047953-63047975 CCCGGGCAGGGCCAGGGCCAGGG + Intergenic
1055329546 9:75169719-75169741 CCTGGGCATGGGTAGGGGCTGGG - Intergenic
1056992527 9:91424347-91424369 CCCGGGCGTGGCCCGGACCTCGG + Intergenic
1057500873 9:95595921-95595943 CCCTGACCTGGGCCTGGCCTGGG + Intergenic
1057752406 9:97803488-97803510 CCCCGCGCTGGGCCGGGCCTGGG - Intergenic
1059769793 9:117414660-117414682 CCCGCGCCGGGGCCGGGGCTGGG - Exonic
1060106440 9:120876320-120876342 CCCGGCCAGGGGCCAGGCCGGGG + Intronic
1060452562 9:123756857-123756879 CCCAGGCTTGGGTTGGGCCTGGG - Intronic
1060663129 9:125415976-125415998 CCCGGGCTTGGGTCGGTTCTAGG + Intergenic
1060827141 9:126693818-126693840 CCGGGGCCGGGGCAGGGCCTGGG + Exonic
1061155955 9:128861772-128861794 CCTGGGCTTGGGCCTGCCCTTGG - Intronic
1061543343 9:131290009-131290031 CCCGGGCACGGGCCCGGCTCTGG - Exonic
1061559445 9:131393734-131393756 GAAGGGCATGGGCCCGGCCTGGG - Intergenic
1061807670 9:133145389-133145411 CCCCGGCATGGCCTGGGCCCAGG + Intronic
1061852080 9:133422281-133422303 CCAGGGCAGGGGCCGTGGCTAGG - Exonic
1061904642 9:133690492-133690514 CCTGGCCATGGGCGGGGCCGTGG - Exonic
1061952768 9:133945561-133945583 CCCGGGCATGGGCCTGCCAGAGG - Intronic
1062048268 9:134434312-134434334 TGCTGGCATGGGCTGGGCCTGGG - Intronic
1062363327 9:136197657-136197679 CCAGGCCTTGGGCCGGCCCTCGG - Exonic
1062389347 9:136327780-136327802 CCGGGGCCGGGGCCGGGGCTGGG + Intronic
1062390409 9:136331519-136331541 CCCAGCCCTGGGCCAGGCCTGGG + Intronic
1062418241 9:136464857-136464879 CTCGGGAGTGGGCCAGGCCTGGG - Intronic
1062457160 9:136645223-136645245 CCCGGGCCGGGCCAGGGCCTAGG + Intergenic
1062473030 9:136714518-136714540 GCCCAGCATGGGCGGGGCCTCGG - Intronic
1062570157 9:137181239-137181261 CCAGGGCAGGGGCCAGGCCTGGG + Intronic
1062624078 9:137435169-137435191 CCTGGGCGTGGGCGGGGCGTGGG - Intronic
1062678533 9:137763204-137763226 GCCCCGCAAGGGCCGGGCCTCGG + Intronic
1062696184 9:137877595-137877617 CCCGGGGCTGGGCCGGGCCCAGG - Intergenic
1203469113 Un_GL000220v1:108540-108562 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1203476934 Un_GL000220v1:152512-152534 GCCGGGCTTCGGCCGGGCCCCGG + Intergenic
1185519560 X:728608-728630 CCGGGGCATTAGCAGGGCCTGGG - Intergenic
1185519647 X:729027-729049 CCGGGGCATTAGCAGGGCCTGGG - Intergenic
1186669833 X:11757851-11757873 CCCGGGCGTGGGAGGCGCCTAGG - Intergenic
1190760428 X:53433835-53433857 CTCGGGCCTGGGCCTGGCCACGG - Exonic
1190881471 X:54495424-54495446 GCCATGCATGGTCCGGGCCTGGG + Exonic
1191249442 X:58253482-58253504 CCAGGGCAAGGGCTAGGCCTGGG - Intergenic
1192320781 X:70088967-70088989 TGTGGGCATGGGCCTGGCCTTGG + Intergenic
1192795214 X:74420670-74420692 GCCGGGCCAGGGCCGGGCCAGGG - Intergenic
1192795219 X:74420681-74420703 GCCGGGTCTGGGCCGGGCCAGGG - Intergenic
1192795233 X:74420708-74420730 GCCGGGTCTGGGCCGGGCCAGGG - Intergenic
1195862391 X:109395875-109395897 CCTGGACCTGGGCTGGGCCTGGG - Intronic
1196441828 X:115725955-115725977 CCCGGGGCAGGGCCGGGGCTGGG - Intergenic
1196912733 X:120500342-120500364 GCCGGGCATGGGCCGGGCGGTGG + Intergenic
1199846399 X:151695272-151695294 CGAGGTAATGGGCCGGGCCTGGG + Intronic
1201190206 Y:11438192-11438214 CCAGGGCAGGGCCCGGGCCAGGG - Intergenic