ID: 1202872658

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177976-177998
Sequence CCGGGCATGGGCCGGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 3, 1: 0, 2: 1, 3: 51, 4: 453}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872644_1202872658 -4 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453
1202872638_1202872658 16 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453
1202872639_1202872658 15 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453
1202872643_1202872658 3 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG 0: 3
1: 0
2: 1
3: 51
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872658 Original CRISPR CCGGGCATGGGCCGGGCCTG GGG Intergenic
900117176 1:1033764-1033786 CTGGGGCTGGGCCGGGACTGGGG - Intronic
900131485 1:1089144-1089166 GTGGGGAGGGGCCGGGCCTGCGG - Intronic
900140240 1:1136806-1136828 CCTGGCACTGGCGGGGCCTGGGG + Intergenic
900242724 1:1624654-1624676 CCGGGCAAGAGCTGGGGCTGCGG + Intronic
900418567 1:2546017-2546039 CCGGGCAGGTGCCTGGGCTGGGG + Intergenic
900419502 1:2549635-2549657 CCGAGCACGGGCCCTGCCTGCGG - Intergenic
900425730 1:2577751-2577773 CCGAGCACGGGCCCTGCCTGCGG + Intergenic
900497614 1:2983080-2983102 CAGGGCCAGGGCCGGGGCTGGGG + Intergenic
900514346 1:3074113-3074135 GCCGGCAGGGGCCGGGGCTGCGG - Intronic
900592128 1:3464840-3464862 CTGGGCAGGAGCTGGGCCTGAGG - Intronic
900594950 1:3476431-3476453 CAGGGGCTGGGCAGGGCCTGAGG + Intronic
900626628 1:3611541-3611563 CCGGGCTGGGGGCGGGCCGGGGG - Intergenic
901525935 1:9823613-9823635 CCGGGGCTGGGCCGGGCCGCTGG - Intronic
902079476 1:13811481-13811503 CTGGACAGGGGCCGGGCCTGGGG + Intronic
902413743 1:16226988-16227010 TCGGGGTTGGGCCGGGCCTGGGG + Intergenic
902448447 1:16482471-16482493 CAGGGCCTGGGCCTGGCCTGGGG - Intergenic
902448647 1:16483595-16483617 CAGGGCCTGGACCTGGCCTGGGG + Intergenic
902506131 1:16939765-16939787 CAGGGCCTGGACCTGGCCTGGGG - Intronic
902506335 1:16940866-16940888 GGGGGCCTGGGCCTGGCCTGGGG + Intronic
902870690 1:19312150-19312172 CCCGGCATGGGCGGGGCCCCCGG - Intergenic
903222893 1:21878682-21878704 CAGGGCATGGGGCAGGGCTGGGG + Intronic
903301129 1:22379461-22379483 CCTGGTCTGGGCCAGGCCTGGGG - Intergenic
904467821 1:30718595-30718617 CAGGGCAGGGGCGGGGCCGGGGG - Intronic
905462202 1:38129211-38129233 CTGGGCCTTGGCCGGGCCTGGGG - Intergenic
905789821 1:40784042-40784064 CCGGGCACGGTCCGGGGCGGGGG - Exonic
906062538 1:42958187-42958209 CGGGGCCGGGGCCGGGCCGGGGG + Intronic
906075527 1:43049250-43049272 CAGGGCAAGGGCAGGGCCAGAGG - Intergenic
906204850 1:43981300-43981322 GAGGGCATGGGCAGGGCCTCGGG - Exonic
906532480 1:46531690-46531712 CCGAGTTTGGGCCCGGCCTGTGG - Intergenic
906652316 1:47521498-47521520 CCGGGGACGGGCTGGGCATGAGG - Intergenic
906688878 1:47779711-47779733 CCTGCCATGGGCCTGCCCTGTGG + Intronic
911176158 1:94820353-94820375 CGGGGCCGGGGCCGGGGCTGGGG - Exonic
913660331 1:121001395-121001417 CGGGCCCTGGGGCGGGCCTGTGG + Intergenic
914011696 1:143784552-143784574 CGGGCCCTGGGGCGGGCCTGTGG + Intergenic
914166136 1:145176582-145176604 CGGGCCCTGGGGCGGGCCTGTGG - Intergenic
914650322 1:149693211-149693233 CGGGCCCTGGGGCGGGCCTGTGG + Intergenic
915544927 1:156591763-156591785 CCGGGGCCGGGCCGGGCCGGGGG + Exonic
917080424 1:171252237-171252259 GAGGGCAGGGGCAGGGCCTGGGG - Intronic
918015985 1:180632524-180632546 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
919763961 1:201114740-201114762 CCTGGCATTGATCGGGCCTGTGG - Exonic
920048701 1:203150395-203150417 CCCGGATTGGGCCTGGCCTGTGG + Intronic
920108281 1:203569715-203569737 CTGGGCATGGGCTGGGTGTGGGG + Intergenic
920159464 1:203985106-203985128 CCAGGCCTGGGCCAGGACTGTGG + Intergenic
920674307 1:208028796-208028818 AAGGGCATGGGCCTGTCCTGAGG + Intronic
921105530 1:211973232-211973254 CCAGGCATAGGCCAGGCGTGGGG - Intronic
921695416 1:218203658-218203680 CCTGTCATGGGCAGGGCCGGGGG + Intergenic
923126760 1:231040263-231040285 CCGGGAAGGGGGCGGGCCGGGGG - Intergenic
1062874016 10:931291-931313 CCGGGCCTGGGCCGGGGCCGGGG - Intronic
1063115075 10:3067387-3067409 AGGGGCAGGGGCCGGGGCTGGGG - Intronic
1063462300 10:6222502-6222524 CCGGGGCTGGGCCGGGCAGGCGG - Intronic
1063665898 10:8060393-8060415 CCTGGCAGGGGCTGGGCTTGGGG + Intronic
1067116234 10:43437277-43437299 GCGGGCAGGGGCCGGGTCTGAGG + Intronic
1067277508 10:44848399-44848421 CACGCCATGGCCCGGGCCTGTGG + Intergenic
1067343024 10:45419517-45419539 CGGGGCATGTGGCTGGCCTGCGG - Intronic
1069676065 10:70248772-70248794 CCAGGCATAGGCCAGGCATGGGG - Exonic
1069856833 10:71445706-71445728 CCTGGCATGGGGCATGCCTGTGG + Intronic
1070649887 10:78227774-78227796 CCAGCCATGGGCATGGCCTGAGG - Intergenic
1072357757 10:94628387-94628409 CTGGGCATGGGGCGGGGGTGGGG - Intergenic
1073045020 10:100632004-100632026 CCGGGCCTGGGCCTGGCCCTTGG - Intergenic
1073139132 10:101236287-101236309 CCGGGCGCAGGCCGGGCATGGGG + Intergenic
1073491372 10:103855410-103855432 CCGTCCCTGGGCCGGACCTGTGG - Intronic
1074821826 10:117185481-117185503 CTGGCCTTGGGCCTGGCCTGAGG + Intergenic
1075591155 10:123692588-123692610 CCTGGGCTGGGCCGGACCTGGGG + Exonic
1075725035 10:124606710-124606732 GGGGGCCTGGGCTGGGCCTGGGG + Intronic
1075885393 10:125895941-125895963 CCGGGCATGGGCCGGGCCTGGGG - Intronic
1076279333 10:129232521-129232543 CCGGGCAGGGGCAGGGGCAGGGG - Intergenic
1076328177 10:129644579-129644601 CCGTGGAAGGGCCGAGCCTGGGG + Intronic
1076683210 10:132185903-132185925 CCAAGCTTGGGCCGGGCCAGAGG - Intergenic
1076855899 10:133115525-133115547 CCAAGCATGGGCCAGGCCTGGGG - Intronic
1076886621 10:133266042-133266064 CCAGGCCTGGGCTGTGCCTGGGG + Intronic
1076922096 10:133459481-133459503 CAGGGCGTGGGCCAGACCTGGGG - Intergenic
1076948202 10:133665676-133665698 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076949191 10:133668986-133669008 CCCGGTGTGCGCCGGGCCTGGGG - Intronic
1076950175 10:133672285-133672307 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076951160 10:133675584-133675606 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076952150 10:133678894-133678916 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076953138 10:133682204-133682226 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076955106 10:133741855-133741877 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076956096 10:133745165-133745187 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076957084 10:133748474-133748496 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076958073 10:133751784-133751806 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076959057 10:133755083-133755105 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1076960046 10:133758393-133758415 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
1077101575 11:824824-824846 CCGATCACGGGCCGGGCCTCGGG - Exonic
1077105770 11:842066-842088 CAGGACATGGGGTGGGCCTGGGG + Intronic
1077141596 11:1027237-1027259 CCGGGCAGGGGCCAGGCGGGGGG - Intronic
1077194572 11:1272719-1272741 CCGGGCGCGGGCCAGGCCTGCGG + Intergenic
1077214696 11:1390468-1390490 CGGGGCCCGGGCCGGGCCTGCGG - Intronic
1077221543 11:1420238-1420260 CAGAGCAGGGGCCGGCCCTGTGG - Intronic
1077353822 11:2105540-2105562 CGGTGCTTGGGCTGGGCCTGGGG - Intergenic
1077360420 11:2138188-2138210 CCGGGCCGGGGCCGGGGCTGGGG - Intronic
1077363881 11:2153701-2153723 CCGGGCATGCACAGGGCGTGTGG - Intronic
1077430074 11:2511934-2511956 GCGGGCATGGACAGGGCATGAGG + Intronic
1077495499 11:2884872-2884894 CGGGGCCGGGGCCGGGGCTGGGG + Exonic
1077609589 11:3636115-3636137 CAGGGCAGGGGCTGTGCCTGGGG + Intergenic
1078066149 11:8080873-8080895 CGGGGCAGGGACCGGGCCGGAGG - Intronic
1079122519 11:17695914-17695936 CCGGGGCCGGGCCGGGGCTGCGG + Intergenic
1080836263 11:35943959-35943981 CCGGGCCGGGGCCGGGCCCGGGG + Intronic
1081636786 11:44727067-44727089 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1081669433 11:44934849-44934871 CCAGGCATGGGCAGGGCCCCAGG + Exonic
1081699897 11:45146501-45146523 CCGGGCAGGGCGCGGGCCTAAGG + Intronic
1081734738 11:45394840-45394862 CCTGGCAGGGGCTGGGGCTGGGG + Intergenic
1081758520 11:45561003-45561025 CTGGTCGTGGCCCGGGCCTGGGG - Intergenic
1083267645 11:61554199-61554221 CCAGTCAGGGGCAGGGCCTGGGG - Intronic
1083320394 11:61842474-61842496 CTGGGCAGGGGCCGGGCAGGGGG + Intronic
1083331352 11:61899899-61899921 CCTGGCATGGAGCAGGCCTGAGG - Intronic
1083395696 11:62390355-62390377 CCAGGCAGGGGCCTGGCCAGTGG - Intronic
1083431552 11:62615954-62615976 CCGGGCCTTGGCCGGGCGCGTGG + Intronic
1083896204 11:65620978-65621000 CCGGGGAAGGGCCGTGCCAGTGG + Intronic
1083997259 11:66278544-66278566 CCGGGCTGGGGCTGGGGCTGGGG + Intronic
1084004812 11:66317104-66317126 GCGGGCCGGGGGCGGGCCTGGGG + Intergenic
1084285555 11:68128474-68128496 GCGGGCAGGGGCGGGGCCCGCGG + Intergenic
1084336604 11:68461201-68461223 CCGGGCGCGGGCCGGGCGGGGGG - Intronic
1084372221 11:68751460-68751482 TGGGGCGTGGGCCGGGCCTCAGG + Exonic
1084489779 11:69471945-69471967 CAGGGCAGGGGCTGGGGCTGGGG - Intergenic
1084556676 11:69879885-69879907 CCAGGAAGGGGCCAGGCCTGGGG - Intergenic
1084575668 11:69986417-69986439 CCGGGGCTGGGCTGGGGCTGGGG + Intergenic
1084641660 11:70429958-70429980 CCCTGCAGGGGCAGGGCCTGGGG - Intronic
1084788516 11:71458360-71458382 GCGGGGAGGGGCAGGGCCTGTGG - Intronic
1084945096 11:72634116-72634138 ACGGGGATGGGGAGGGCCTGAGG + Intronic
1088579352 11:111300111-111300133 CTGGGGAGGGGCCAGGCCTGGGG - Intronic
1089262606 11:117232807-117232829 CGGGGCGAGGGCCGGGCATGGGG + Intronic
1089572700 11:119420843-119420865 CCCGGCATGGGGCAGGACTGGGG - Intronic
1090247950 11:125230059-125230081 CTTGGCCTGGGCAGGGCCTGAGG + Intronic
1090632398 11:128661301-128661323 CTGGGGATGGGCTGGACCTGTGG + Intergenic
1090792745 11:130105989-130106011 ACAGGCATCGGCCGGGCGTGGGG - Intronic
1090803258 11:130187710-130187732 CCAGTCATGGGCCTGGGCTGGGG + Intronic
1091730533 12:2877094-2877116 CCGGGCCGGGGCCGGGGGTGGGG + Intronic
1091915354 12:4269280-4269302 CCGGGCAGGGTCCGGGCCCTGGG - Intergenic
1092246637 12:6867709-6867731 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1096496997 12:52044355-52044377 CCGGGCAAGGGCCCGGCAAGCGG - Intronic
1096676239 12:53227602-53227624 GTGGGCATGGGCAGGGGCTGTGG - Exonic
1098164496 12:67679649-67679671 CCTGGCAGCGGCCGGGCGTGGGG - Intergenic
1102111875 12:110371203-110371225 CTGGGCCTGGGCCAGGCCTCTGG + Intergenic
1103359091 12:120342962-120342984 CAGGGCAGGGGCCGGGCCCGGGG + Exonic
1103626820 12:122226235-122226257 CGGGGCATATGCAGGGCCTGAGG + Exonic
1103764618 12:123271493-123271515 CCGGGCCGGGGCCGGGCGCGCGG + Intronic
1104989855 12:132619160-132619182 CGGGGCAGGGGCTGGGACTGGGG + Intronic
1105009639 12:132747025-132747047 CCTTGCATGGGCCTGGCCCGGGG + Intronic
1105603440 13:21907892-21907914 CCAGGCAAGGGCTTGGCCTGGGG - Intergenic
1107133577 13:36920534-36920556 CCGGGCAGGGGCCGAGCCTGGGG - Intronic
1108478444 13:50843456-50843478 CCGGGCCCCGGCCGGGCCCGCGG + Exonic
1108620031 13:52173113-52173135 CCAGGCATGGTGCAGGCCTGTGG + Intergenic
1108666710 13:52640078-52640100 CCAGGCATGGTGCAGGCCTGTGG - Intergenic
1113523444 13:110956117-110956139 CCCGGCAGGGCCCGGGACTGCGG - Intergenic
1113701860 13:112394379-112394401 CCCGGCAGGGCCCGGGACTGCGG + Intronic
1113769229 13:112897977-112897999 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1113851420 13:113420865-113420887 CCGGGGGTGGGCGGGTCCTGGGG - Intergenic
1113874402 13:113585157-113585179 CGGGGCCGGGGCCGGGGCTGGGG + Intronic
1113923788 13:113929277-113929299 CAGGGCCTGGGCCAGCCCTGAGG - Intergenic
1117338641 14:54775662-54775684 CTGGGCAGGGGTGGGGCCTGGGG - Intronic
1118738157 14:68717256-68717278 CCGAGTAAGGGCCGGGCATGCGG - Intronic
1119743517 14:77028507-77028529 CCGGGCGCCGGCCAGGCCTGGGG - Exonic
1120786790 14:88545432-88545454 CTGGGCATGGGCACTGCCTGGGG - Intronic
1122425250 14:101601924-101601946 CCAAACATGGGGCGGGCCTGTGG - Intergenic
1122789704 14:104179085-104179107 GCGGGCAGGGGGCGGACCTGGGG - Intronic
1122889015 14:104724156-104724178 CGGGGCAGGGGGCGGGCCGGGGG - Intergenic
1122995591 14:105262134-105262156 CCAGGCATGTGCGGGGCCTGAGG - Intronic
1123010903 14:105349099-105349121 CGGGGCCTGGGCCAGGCATGGGG - Intronic
1123041327 14:105491417-105491439 CCGGGCCGGGGCCCTGCCTGAGG + Exonic
1202872658 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG + Intergenic
1124552304 15:30693064-30693086 CCCCGGATGGGCCGTGCCTGTGG + Intronic
1124678935 15:31712602-31712624 CCCCGGATGGGCCGTGCCTGTGG - Intronic
1126348267 15:47718463-47718485 CCGGGCCTGGGCCGGGGATGGGG - Intronic
1128537235 15:68500547-68500569 CCCTGCATGGGCCTGCCCTGGGG - Intergenic
1129519650 15:76177774-76177796 CTGGGCTTGTGCCGGGCATGTGG + Intronic
1132105412 15:99059342-99059364 GTGGGCACGGGCCGGGCCCGCGG - Intergenic
1132499818 16:280362-280384 CCGGGCACGGGCCGGGCGGGCGG + Intronic
1132508509 16:324823-324845 CTGGGCCTGGGAAGGGCCTGCGG - Intronic
1132552988 16:560849-560871 GAGGGCAGGGGCCGGGTCTGGGG + Intronic
1132572386 16:649684-649706 GCGGGGCTGGGCCGGGCCTCGGG - Intronic
1132639440 16:971000-971022 CCGAGAATGGGCGGGGCCTCCGG - Intronic
1132649412 16:1013815-1013837 GGGGGCCTGGGCGGGGCCTGGGG + Intergenic
1132681927 16:1145955-1145977 CCGGGGCTGGGCCTGGGCTGGGG + Intergenic
1132683850 16:1154146-1154168 CCTGGCGTGGGCCGGGCGCGCGG + Intronic
1132755659 16:1483536-1483558 CTAGACATGGGCCGGGCCTTGGG + Intergenic
1132827782 16:1913677-1913699 CCTGGCAGGGGCCGGTCCTGGGG - Intronic
1132842297 16:1984083-1984105 CCGGGCCCGAGCCGGGGCTGGGG - Intronic
1132925965 16:2429301-2429323 CGGGACATGGGCGGGGCCGGCGG + Intergenic
1132931487 16:2461137-2461159 CCAGGCCTGGGGCGGGCCTCAGG + Exonic
1133156714 16:3880926-3880948 CCCGGCGCGGGCCAGGCCTGCGG + Intergenic
1133229294 16:4359168-4359190 CTGGGCTGGGGCTGGGCCTGGGG - Intronic
1133784435 16:8963606-8963628 CGGGGCCGGGGCCGGGGCTGCGG + Intronic
1136453892 16:30369938-30369960 CGGGGCTGGGGCCGGGGCTGGGG + Exonic
1136483776 16:30558220-30558242 CCTGGCCTGGCCTGGGCCTGCGG + Exonic
1138105696 16:54286134-54286156 CGGGGGCTGGGCCGGGCTTGGGG + Exonic
1138196573 16:55056800-55056822 CTGGGGATGGGCCCGGCCGGCGG - Intergenic
1138554502 16:57763770-57763792 GCTGCCTTGGGCCGGGCCTGGGG - Intronic
1139403027 16:66696913-66696935 CGGGGCCAGGGCGGGGCCTGAGG - Intergenic
1139485747 16:67255702-67255724 CCGGGTAGGGTCCGGGCCAGGGG + Intronic
1139544783 16:67645077-67645099 GCGGGGAGGGGCCGGGCCGGGGG + Exonic
1139846483 16:69924932-69924954 CTGGGCGTGGGCAGGGCTTGTGG + Intronic
1141083752 16:81076959-81076981 CTGGGGAGGGGCGGGGCCTGAGG - Intronic
1141487465 16:84350328-84350350 CGGGGCAGGGACAGGGCCTGCGG + Intergenic
1141623930 16:85251582-85251604 CTGGGCAGGGGCTGGGCCCGGGG + Intergenic
1141897127 16:86965223-86965245 CCGAGCACGGGCTGGGGCTGGGG - Intergenic
1142009725 16:87707726-87707748 CCGGGCCAGGGCTGGGCCTAGGG - Intronic
1142190460 16:88714942-88714964 CCTGTCCTGGGCCGGGCTTGGGG + Intronic
1142262706 16:89050290-89050312 CGGGGCATGGGACGGGGCTGTGG + Intergenic
1143028766 17:3955735-3955757 CTGGGCAGGGGCGAGGCCTGGGG + Intronic
1143240457 17:5439148-5439170 CCGGGCAGGGGCGGGGCTTCCGG - Exonic
1143323152 17:6080929-6080951 CCGGGCCGGGGCCGGGTCAGGGG - Exonic
1143512841 17:7405490-7405512 GCGGGCGGGGGCTGGGCCTGCGG + Intronic
1143575014 17:7787080-7787102 GAGGGCGTGGGCCGGGGCTGGGG + Intronic
1143730291 17:8878585-8878607 CCAGGGAGGGGACGGGCCTGAGG - Intergenic
1143762850 17:9117310-9117332 CCAGGGAAGGGCCCGGCCTGGGG + Intronic
1144576921 17:16435301-16435323 CCAGGCCTGGGCTGAGCCTGGGG + Intronic
1144586832 17:16492218-16492240 CCGGGCCGGGGCGGGGCCGGCGG - Intergenic
1144798334 17:17907688-17907710 CCGGGAAAGGTCCTGGCCTGAGG + Intronic
1144948821 17:18983171-18983193 CCTGGGCTGGGCCGGGACTGAGG + Intronic
1145399017 17:22516379-22516401 CTGGGGATGAGCTGGGCCTGGGG - Intergenic
1145750162 17:27349567-27349589 CTGGGCCGGGGCCGGGTCTGGGG - Intergenic
1145840019 17:27986930-27986952 ACAGGCGTGGGCAGGGCCTGGGG - Intergenic
1146675945 17:34774002-34774024 CCTGGCATGGTCCTGGCCTTTGG - Intergenic
1146970490 17:37067912-37067934 CTGGGCCTGGGCCAGGGCTGTGG + Intergenic
1147330603 17:39696827-39696849 CAGGGCAGGGGTGGGGCCTGGGG + Intronic
1147659106 17:42107827-42107849 CAGGGCAGGGGGCGGGGCTGTGG - Intronic
1147683865 17:42275791-42275813 CCGGGGATGGGATGAGCCTGCGG - Intronic
1148213485 17:45821724-45821746 CTGGGCATGGGACTGTCCTGGGG + Intronic
1148351644 17:46945735-46945757 CCAGGCATGTGCAGGGACTGAGG + Intronic
1148503302 17:48107843-48107865 GAGGGCGTGGGCGGGGCCTGGGG + Intronic
1149548367 17:57521275-57521297 GCCGGCAGGGGCTGGGCCTGGGG - Intronic
1149994319 17:61399081-61399103 CAGGGCGGGGCCCGGGCCTGCGG + Intergenic
1150249741 17:63699205-63699227 CCGGACAGGAGCCTGGCCTGGGG - Intronic
1150628010 17:66855637-66855659 CCAGGCGTGGTCCGAGCCTGAGG - Intronic
1150791880 17:68205736-68205758 CGGGGCAGGGGCCGGGGCAGGGG - Intergenic
1151433996 17:74082918-74082940 CGGTGCATGGGACAGGCCTGTGG - Intergenic
1151443754 17:74150178-74150200 CCAGGCAGGGGCCTTGCCTGGGG - Intergenic
1151724945 17:75878275-75878297 CCGGGCCGGGGCCGGACCCGGGG + Exonic
1151855500 17:76718670-76718692 CGCGGCAAGGGCAGGGCCTGGGG - Intronic
1152087853 17:78231514-78231536 CCTGGCACGGGCTGGCCCTGGGG - Exonic
1152381539 17:79944880-79944902 CAGGGCAGGGGCCAGGGCTGGGG - Intronic
1152396367 17:80035922-80035944 CCGGGCCGGGGGCGGGCCCGGGG - Intergenic
1152396373 17:80035933-80035955 GCAGGCAGGGGCCGGGCCGGGGG - Intergenic
1152429597 17:80240963-80240985 CCGGGCATGGACCACACCTGTGG + Intronic
1152540486 17:80972026-80972048 CCAGGCAGGGGCCAGGACTGGGG - Intergenic
1152545149 17:80996737-80996759 CCAGGCATGGGCCTGTCCTGAGG - Intronic
1152614962 17:81333786-81333808 TGGGGCATGGGGCGGCCCTGTGG + Intergenic
1152617161 17:81343285-81343307 CCGAGCATGGCCCGGCCCGGCGG + Intergenic
1152811002 17:82382875-82382897 CCAGGGAAGGGCAGGGCCTGGGG - Intergenic
1154274528 18:12947878-12947900 CGGGGCGTGGGCAGGGCTTGAGG + Intronic
1156290893 18:35747912-35747934 CCAGGCTTGAGCTGGGCCTGGGG - Intergenic
1156479264 18:37426041-37426063 CAGGGCAAGGGCTGGGGCTGGGG - Intronic
1157487840 18:48101089-48101111 CAGGGACTGGGCTGGGCCTGTGG - Intronic
1159601198 18:70430363-70430385 CCGGGCCAGGGCCGAGGCTGCGG + Intergenic
1160726145 19:618669-618691 CCGGGCTGGGGCCTGGCCGGGGG - Intronic
1160738094 19:673934-673956 CCAGGCCTGACCCGGGCCTGGGG - Intergenic
1160781139 19:878428-878450 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1160788769 19:913235-913257 GCGGGCAGGGGCGGGGCCTGGGG + Intronic
1160903103 19:1438914-1438936 GCGGGCAGGGGCTGGGCCAGCGG + Intronic
1161150107 19:2702872-2702894 CCGGGCGCGGGCGGGGCCGGGGG + Intergenic
1161170154 19:2808457-2808479 CCGGGCAGGGGCAGGGGCAGGGG + Intronic
1161681292 19:5681084-5681106 CCGGGGAGGGGCCGGGCCTCGGG - Exonic
1161701867 19:5800181-5800203 CTCGGCATGGGTTGGGCCTGGGG + Intergenic
1161726708 19:5933517-5933539 CTGGGCTGGGGCTGGGCCTGGGG + Intronic
1161736889 19:5997012-5997034 CCGGGGCTTGGCCGGGCCTGTGG - Intronic
1162015641 19:7845178-7845200 CCGGGCAGTGGGCGGGCATGAGG + Intronic
1162033082 19:7925701-7925723 CCGGGCATGGGCGTAGCCCGGGG - Intronic
1162159131 19:8698629-8698651 TGGGGTTTGGGCCGGGCCTGGGG + Exonic
1162403685 19:10461238-10461260 CCGGGCAGGAGGCGGGGCTGGGG + Intronic
1162781368 19:13008625-13008647 CCAGGCCTGGGCAGGGCCAGCGG - Intronic
1162909906 19:13842979-13843001 CCGGGCAGGGGGCGGGCGCGGGG + Intergenic
1162929960 19:13952772-13952794 CAGGGCCTGGGCGGGGCCCGGGG + Intronic
1163018455 19:14470692-14470714 CCCGACGTGGGGCGGGCCTGGGG + Intronic
1163271704 19:16258526-16258548 CCTGGCCTGGGCAGGGGCTGTGG - Intergenic
1163296656 19:16417131-16417153 CAGGTCATGGGCAGAGCCTGTGG - Intronic
1163365095 19:16871409-16871431 CCGGGGTGGGGCCGGCCCTGAGG + Intronic
1163578306 19:18123393-18123415 CCAGGGAGGGGCCGGGGCTGGGG - Intronic
1163609033 19:18291736-18291758 CTGGGGAAGGGCGGGGCCTGCGG + Intergenic
1163666676 19:18606852-18606874 CCGGGGCCGGGCCGGGCCGGGGG - Intronic
1165096533 19:33412793-33412815 CCGGGCAGGGGCCAGACCCGAGG + Intronic
1165639281 19:37370573-37370595 CCTGCCATGGGCGGGGTCTGTGG - Intergenic
1165994882 19:39836901-39836923 CCAGCCCTGGGCCGGGCGTGGGG + Intronic
1166043217 19:40215336-40215358 GCGGGCTGGGGCAGGGCCTGGGG - Exonic
1166179368 19:41095991-41096013 CGGGGCAGGGGCGGGGCTTGTGG + Exonic
1166727802 19:45039260-45039282 CGGGGCACGGGCTCGGCCTGAGG - Intronic
1166778909 19:45329702-45329724 CCAGGTATGGGCCGGGCCGGTGG - Intergenic
1167311175 19:48738876-48738898 CGGGGCCTGGGCGGGGCTTGTGG - Intronic
1168316474 19:55486782-55486804 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
1168468939 19:56625499-56625521 CCAGGCTTGGGTCAGGCCTGGGG - Exonic
1168670608 19:58238442-58238464 CCAGGCATGGGGCAGGCTTGTGG + Intronic
925984723 2:9206717-9206739 CCGGGCGTGGGGCGGGGCGGCGG - Intergenic
926093438 2:10065128-10065150 CAGTGCAGGGGCCGGGTCTGAGG - Intronic
926159158 2:10475614-10475636 GGAGGCCTGGGCCGGGCCTGAGG + Intergenic
926305812 2:11636784-11636806 ACGGGCATGGGCAGGGGCAGAGG + Intronic
926706887 2:15843472-15843494 CCGAGGAAGGGCTGGGCCTGTGG + Intergenic
926718612 2:15942681-15942703 CGGGGCACTGGCCGGGGCTGCGG - Exonic
929788540 2:45008430-45008452 CTGGGCTGTGGCCGGGCCTGGGG + Intronic
931640786 2:64379378-64379400 CCTGGCATGGGCCGTGCCCTGGG + Intergenic
931649451 2:64454672-64454694 CCGGGCGCCGGCCGGGCCTGCGG - Intronic
931671745 2:64653957-64653979 GCGGCCAGGGGCGGGGCCTGCGG - Intronic
932621775 2:73269087-73269109 CGGGGCAAGGGCCGGGGCCGGGG + Exonic
932812429 2:74835625-74835647 CCGGGGACGGGCAGGGCCAGGGG + Intronic
934567696 2:95349662-95349684 CAGGGCATGGGCCTGGCCAGAGG + Intronic
935108684 2:100072085-100072107 CTGGGCATGGGCTGGACATGGGG - Intronic
935692579 2:105744760-105744782 CCGGGCCTGGGCCGGCCCCTGGG + Intergenic
937141683 2:119607278-119607300 CCAGGTATGGGCCGGGTGTGGGG - Intronic
941911918 2:170771593-170771615 CCGGGCAAGGGCAAGGACTGAGG - Intergenic
946410939 2:219514878-219514900 CATGGACTGGGCCGGGCCTGTGG + Exonic
947026258 2:225741251-225741273 CCGGGCATGGGTCTTGCCTGTGG - Intergenic
948202859 2:236142371-236142393 CGGGGCAGGGGCCGGGGCGGGGG - Intergenic
948305597 2:236944802-236944824 CCGGGTGTGGGCTGGGACTGGGG - Intergenic
948410691 2:237757805-237757827 CCGTGGCTGGGCCGGGCCGGTGG + Intronic
948462965 2:238139083-238139105 CCGGGCCTGGGCAGGCACTGGGG + Intronic
948492271 2:238320948-238320970 CCGGGTGTGGGCCGGGCTCGGGG + Intronic
948657796 2:239487366-239487388 CAGGACATGGGCAGGCCCTGTGG + Intergenic
948697171 2:239737938-239737960 CCGGGGCTGGGCTGGGGCTGGGG - Intergenic
948697283 2:239738161-239738183 CGGGGCTGGGGCCGGGGCTGGGG - Intergenic
948697372 2:239738324-239738346 CTGGGCCTGGGCCGGGGCTGGGG - Intergenic
948912116 2:241009942-241009964 CGGGGGATGGGCAGGGCCTCCGG - Intronic
1168769998 20:408623-408645 CAGGGCTTGGGCCGCGCCGGAGG + Exonic
1169038246 20:2470877-2470899 CCGAGCAGAGGCGGGGCCTGGGG + Intronic
1172391136 20:34566303-34566325 CTGGCCCTGTGCCGGGCCTGGGG - Intronic
1172424901 20:34849300-34849322 CCAGGCATGGCACGTGCCTGTGG - Intronic
1172443195 20:34979810-34979832 CCGCCCATGGCCCGGGCCTGGGG - Intronic
1172775673 20:37405293-37405315 CTGGCTCTGGGCCGGGCCTGGGG + Exonic
1173139660 20:40470947-40470969 AGGGGCCTGAGCCGGGCCTGCGG - Intergenic
1173229766 20:41185087-41185109 CCGGGCATGGGAACGGCATGTGG + Exonic
1174135515 20:48376177-48376199 CAGGGCAGGGGCCGGGGGTGGGG + Intergenic
1175847192 20:62065270-62065292 CGGGGCCGGGGCCGGGCCCGGGG + Exonic
1175897698 20:62346641-62346663 CTGGGAATGGGCTGGCCCTGAGG - Intronic
1176101570 20:63366814-63366836 CCGGTCAAGGTCGGGGCCTGGGG + Intronic
1176159678 20:63641890-63641912 GCGGGCAGGGGCCGGGGCGGGGG - Intronic
1176159732 20:63642015-63642037 GCGGGCAGGGGCCGGGGCGGGGG - Intronic
1176168325 20:63685933-63685955 CTGGGCATGTGCCTAGCCTGTGG - Intronic
1176223551 20:63981300-63981322 CCGGGGCTGGGCCGGGGGTGAGG + Exonic
1176555727 21:8253305-8253327 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1176574664 21:8436339-8436361 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1176611277 21:8987631-8987653 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1178948395 21:36966687-36966709 CCGGGGCGGGGCCGGGCCTGGGG - Intronic
1179564988 21:42241836-42241858 CCAGGCATGGGGCATGCCTGTGG + Intronic
1179990299 21:44944750-44944772 CAGGGCAGGAGCCGGGTCTGGGG + Intronic
1180001604 21:44997760-44997782 CCGGGGGAGGCCCGGGCCTGTGG + Intergenic
1180064279 21:45405030-45405052 CCGGGCAGGGGCCGGGCAGGGGG - Intergenic
1180064311 21:45405091-45405113 CCGGGCAGGGGCCGGGCAGGGGG - Intergenic
1180109949 21:45643105-45643127 CCAGGCTTGGGGCGGGCCTGTGG - Intergenic
1180285437 22:10741500-10741522 CCGGGCATGGGCCGGGCCTGGGG - Intergenic
1180843601 22:18970357-18970379 GCGGGCCTGGGCGGGGGCTGGGG - Intergenic
1181323959 22:22030787-22030809 CCTGGGCTGGGCCTGGCCTGAGG - Intergenic
1181483791 22:23218182-23218204 CAGGGCACTGGCAGGGCCTGAGG - Intronic
1182494250 22:30695063-30695085 TCGGGCACGGGCTGGGGCTGGGG - Exonic
1183257171 22:36770114-36770136 AGGGGCAAGGGCTGGGCCTGGGG + Intronic
1183650833 22:39152467-39152489 CCGGGGCCGGGCCGGGCCGGGGG + Exonic
1183697695 22:39432508-39432530 CTGGGCAGGGGCTGTGCCTGCGG + Intronic
1183736397 22:39647069-39647091 CCTGCGCTGGGCCGGGCCTGGGG + Intronic
1184658651 22:45955235-45955257 AATGGCATGGGCCAGGCCTGGGG - Intronic
1184698008 22:46150513-46150535 CCGGGCATGGGCCGTGGACGCGG + Intronic
1203252711 22_KI270733v1_random:125389-125411 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1203260768 22_KI270733v1_random:170476-170498 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
949970328 3:9397938-9397960 CGGGGCCTGGGCCCGGGCTGCGG - Exonic
950702155 3:14758075-14758097 CTGGGCATGGACCGGGCCCTGGG + Intronic
951217740 3:20040525-20040547 CGGGGCAGGGGCCGGGCCCGGGG + Exonic
953901421 3:46846067-46846089 CGGGGCCTGGGCCGGGGCCGGGG - Intergenic
954004013 3:47578305-47578327 CGGGGCCGGGGCGGGGCCTGAGG - Intronic
954278009 3:49554800-49554822 CCGGGCCAGGGCCGGGACCGGGG - Exonic
954332589 3:49898839-49898861 GTGGGCAGGGGCAGGGCCTGGGG - Intronic
954384306 3:50236305-50236327 CCGGGCGGCGGCCGGGCCGGCGG + Exonic
954535752 3:51358175-51358197 CTGGGCAGGGGCCGGGGTTGGGG + Intronic
955064809 3:55525291-55525313 CCAGCCATGGGCCAGGACTGGGG + Intronic
960925982 3:122795242-122795264 CCGGGCTCGGGCCTGGGCTGGGG + Exonic
960968782 3:123124387-123124409 CGGGGCATCTGCCGGGCCTGAGG + Intronic
960989271 3:123300324-123300346 CCGGGGTCGGGCAGGGCCTGGGG - Intronic
961469132 3:127100587-127100609 CCAGGGATGGGGCGGGCCTGCGG - Intergenic
961666845 3:128497953-128497975 CCGGGCTGGGGCCGGGGCCGGGG - Intergenic
964246484 3:154659794-154659816 CCAGGCAGGGGCCAGGGCTGAGG + Intergenic
967941197 3:194768006-194768028 CCCGTCTTGGGCAGGGCCTGGGG + Intergenic
968083592 3:195863856-195863878 CTGGTCCTGGGCGGGGCCTGTGG - Exonic
968233291 3:197016622-197016644 CCAGGCATGGGACGGTCCTGAGG + Intronic
968450321 4:673033-673055 CCGGGCATGGCCCGGTGCGGTGG - Intronic
968478962 4:825664-825686 CCGGGCGCGGGCCGGGACCGCGG + Intronic
968485522 4:859173-859195 CAGCGCCCGGGCCGGGCCTGAGG + Intronic
968578527 4:1379023-1379045 CCTAGCGTGGGCCGTGCCTGGGG + Intronic
968603609 4:1521220-1521242 CCGGGCATGGGCGAGGCTGGAGG - Intergenic
968615993 4:1578133-1578155 CCAGGCTTGGGGGGGGCCTGGGG - Intergenic
968831350 4:2934320-2934342 CGGGGCGCGGGCCGGGGCTGGGG - Exonic
969295718 4:6269820-6269842 CGGGGCAGGGGCGGGGCCTTCGG - Intergenic
969662872 4:8540578-8540600 TGGGGCAGGGGCGGGGCCTGGGG + Intergenic
970884624 4:20973762-20973784 CAGGGAATAGGCCGGCCCTGTGG + Intronic
972321639 4:37977606-37977628 CCGGGGCTGGGCCGGGCCGCTGG + Intronic
974849337 4:67386051-67386073 CTGGGCATGGGCCCAGCATGCGG + Intergenic
976530093 4:86141882-86141904 CAGGGCATGGCCCTGGCTTGTGG + Intronic
980405069 4:132344907-132344929 CGGGGCTGGGGCCGGGGCTGGGG + Intergenic
980405074 4:132344919-132344941 CGGGGCTGGGGCCGGGGCTGCGG + Intergenic
981031726 4:140132095-140132117 CAGAGTGTGGGCCGGGCCTGAGG - Intronic
985033447 4:185814903-185814925 CTGGGCTAGGGCAGGGCCTGAGG - Intronic
985451659 4:190066485-190066507 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985452646 4:190069776-190069798 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985453632 4:190073073-190073095 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985454622 4:190076366-190076388 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985455610 4:190079659-190079681 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985456594 4:190082953-190082975 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985457582 4:190086253-190086275 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985458569 4:190089546-190089568 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985459558 4:190092846-190092868 CCCGGTGTGCGCCGGGCCTGGGG - Intergenic
985720724 5:1487243-1487265 CCGTGCCTGGGCGTGGCCTGTGG - Intronic
985853144 5:2403496-2403518 CAGGGCATAGGCTGGGGCTGAGG + Intergenic
985895582 5:2748659-2748681 CCGAGCCTGGGCCCGGGCTGCGG - Exonic
986608662 5:9546272-9546294 CCGGGAAGGGGCGGGGCCCGGGG - Intergenic
986695946 5:10354137-10354159 CCGGGCAGGGGCCGGGGCCGGGG + Intronic
986739000 5:10689377-10689399 CCTGGAATGAGCTGGGCCTGTGG - Intronic
989478784 5:41904284-41904306 CCCGGCACGGGCGGGGCCTAGGG - Intronic
989637982 5:43556765-43556787 CCGCGGAGGGGGCGGGCCTGAGG - Exonic
990003663 5:50922328-50922350 CAGGGCCTGGGCAGGGCCTGAGG - Intergenic
992141720 5:73803943-73803965 CCGGGCATGGTACATGCCTGTGG + Intronic
992563149 5:77972581-77972603 CCCGGCCCGGGCCGGGCCAGGGG + Intergenic
992796091 5:80256125-80256147 GCGGGCACGGGGCGGGGCTGGGG - Intergenic
992950964 5:81857559-81857581 CTGGGCATAGGCCCGGCCTCTGG - Intergenic
994999700 5:107111663-107111685 CCTGGCAGGGGCCGGGGGTGGGG + Intergenic
997235646 5:132270731-132270753 CTGGGGAAGGGCTGGGCCTGGGG - Intronic
997980600 5:138465547-138465569 TGGGGCAGGGGCCGGTCCTGCGG - Exonic
1001205974 5:169763503-169763525 ACGGGCCTGGGCTGGGCATGTGG + Intronic
1001719053 5:173841518-173841540 TGGGGCAGGAGCCGGGCCTGGGG - Intergenic
1002170332 5:177371068-177371090 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1002871375 6:1169922-1169944 CCTGGCCTGGGAGGGGCCTGGGG + Intergenic
1003086990 6:3068454-3068476 CCCGGCAAGGGCCGGGGCAGGGG + Exonic
1003566745 6:7229141-7229163 CCAGGCAGGGGCGTGGCCTGCGG - Exonic
1006515318 6:34542187-34542209 GGGGGCAGGGGCCGGGCCTGAGG + Intronic
1006645391 6:35511751-35511773 CCGGGCCTGGGCTGGGTCTGGGG + Exonic
1006752578 6:36387845-36387867 CAGGGCAGGGGCCGGCCCCGTGG + Intergenic
1006790536 6:36698366-36698388 CCTGGCATGGGCCCTGCCTGGGG - Intronic
1006838571 6:37014077-37014099 CTGGGCATCGGCCTGGTCTGGGG - Exonic
1007702793 6:43774294-43774316 ATGGGCATGGGCAGGGGCTGGGG - Intronic
1011113066 6:83859753-83859775 CCGGGCAGGGCCCGGGGCCGGGG + Exonic
1011610567 6:89146496-89146518 CCCGGCATCGGCCACGCCTGCGG + Exonic
1012475743 6:99613623-99613645 CTGGGCGGGGGCCGGGCGTGCGG + Exonic
1014477244 6:121888747-121888769 CAGGGCATGGGGCGGGCGTGGGG - Intergenic
1016590153 6:145735319-145735341 CCCTGCAGGAGCCGGGCCTGTGG - Exonic
1018023890 6:159789371-159789393 CCGGGCCTGGGTCGGGTTTGCGG - Intronic
1019148766 6:169990676-169990698 CCAGGCATTGGCCCTGCCTGGGG + Intergenic
1019214673 6:170435467-170435489 CCGGGCCTGAGCCTGGCGTGGGG - Intergenic
1019303660 7:322293-322315 CCAGGGATGGGCCGGGCCGCGGG + Intergenic
1019349012 7:544499-544521 CCAGGCAAGGGCTGGGTCTGGGG - Intergenic
1019379147 7:712287-712309 GCGGGGCGGGGCCGGGCCTGGGG - Intronic
1019648257 7:2142398-2142420 CCAGGCATGGTCCGGGGCTGCGG + Intronic
1019692323 7:2423131-2423153 CCGGGCATGGTGCGTGCCTGTGG + Intronic
1020083061 7:5296744-5296766 GCGGTGATGGGCGGGGCCTGTGG + Intronic
1020106539 7:5424707-5424729 CCGGGCCTGGGCCGAGCGGGGGG - Intronic
1023599218 7:41865069-41865091 CCCGGCATGGGCCAGGCATGAGG + Intergenic
1023850286 7:44146307-44146329 CCGGGCGTGGGCGGGGCCCGGGG - Intronic
1023935833 7:44739161-44739183 TGGGGCATGGGTGGGGCCTGAGG + Intergenic
1023938979 7:44758058-44758080 CGGGGCAGTGGCTGGGCCTGGGG - Exonic
1023984341 7:45086157-45086179 CCAGGCAAGGGCCAGGCCCGGGG + Intronic
1024005808 7:45224396-45224418 CAGGCTATGGGCCAGGCCTGGGG - Intergenic
1024025636 7:45408014-45408036 CCAGGCAAGAGCAGGGCCTGTGG - Intergenic
1024284386 7:47744573-47744595 ACAGGCATGAGCCCGGCCTGTGG - Intronic
1026702139 7:72655959-72655981 GCAGTCATGGGCTGGGCCTGTGG - Intronic
1026929909 7:74218045-74218067 CTGGGGGTGGGCAGGGCCTGAGG - Intronic
1026941083 7:74288460-74288482 CTGGGCATGGACAGGGGCTGGGG + Intergenic
1027134091 7:75611983-75612005 CTGGGCCTGGGCCTGGCCTGTGG + Intronic
1027244689 7:76359073-76359095 CGGGGCATGGGCGGGGCTTGCGG - Intergenic
1029381368 7:100217332-100217354 CCTGGCCTGGGCCTGGCCAGTGG - Intronic
1029400798 7:100344642-100344664 CCTGGCCTGGGCCTGGCCAGTGG - Intronic
1029608957 7:101616367-101616389 CTGGGCAGGGGCTGGGGCTGGGG + Intronic
1032756008 7:134891536-134891558 CAGGGCGTGGGCTGGGCCCGCGG - Intronic
1033130691 7:138743168-138743190 CCAGGATTGGGCCGGGCGTGTGG + Intronic
1034830669 7:154305067-154305089 CCGGGCTGGGGCTGGGGCTGGGG - Intronic
1036648838 8:10629278-10629300 CAGGGCATGGGCCCTGCCTGGGG + Intronic
1037450777 8:19013919-19013941 CAGGGCAGGGGCGGGGCCTCCGG + Intronic
1037991139 8:23321951-23321973 CCGGGCCAGGGCCAGGCCCGAGG + Intronic
1038248647 8:25882271-25882293 CAGGGCATGCGACGGGGCTGTGG - Intronic
1039478555 8:37854946-37854968 CAGGGCAGGGGCGGGCCCTGAGG - Intergenic
1039608484 8:38901419-38901441 CCGTGCAGGGGCCGGGGCTCGGG - Exonic
1041502478 8:58553554-58553576 CCGGGCTGGGGCTGGGGCTGGGG + Intronic
1043847273 8:85177464-85177486 CAGGGCAGGGGCAGGGCCAGCGG + Exonic
1045472993 8:102529028-102529050 CCGGGGTGGGGCGGGGCCTGGGG - Intronic
1047998620 8:130358730-130358752 CGGGGCGGGGGCCGGGCCGGGGG - Intronic
1049309025 8:141923610-141923632 CTGGGCATGGGCCCTGCTTGTGG - Intergenic
1049396393 8:142403055-142403077 CCTGGCCGGGGCCGGGCGTGGGG - Intronic
1049471566 8:142777243-142777265 GCGGGACTGGGCTGGGCCTGCGG - Intronic
1049509502 8:143020372-143020394 CCGGGCGTGGTACGTGCCTGTGG - Intronic
1049687271 8:143944016-143944038 CCGCGTATGGGGCGGTCCTGCGG - Intronic
1049709972 8:144059063-144059085 TCAGGCATGGGCACGGCCTGGGG + Exonic
1050472319 9:6007111-6007133 CCGAGGATGGGCTGGGCCAGGGG - Intronic
1051629370 9:19127727-19127749 CCGGGCGGGGGCCCGGCCTGGGG + Intronic
1053188274 9:36037194-36037216 CCGGACGTGGGCAGGGTCTGGGG - Intronic
1053752731 9:41273335-41273357 CCGGGCGGGGGCAGGGTCTGGGG - Intergenic
1054459298 9:65454226-65454248 CCGGGCTTGGGCTGGGCCCCTGG - Intergenic
1055329545 9:75169718-75169740 CTGGGCATGGGTAGGGGCTGGGG - Intergenic
1055477549 9:76678079-76678101 CTGGGGATTGGCCGGGCTTGGGG + Intronic
1057269867 9:93644739-93644761 TGGGGCATGGGCTGGGGCTGAGG + Intronic
1057500875 9:95595922-95595944 CCTGACCTGGGCCTGGCCTGGGG + Intergenic
1057752404 9:97803487-97803509 CCCGCGCTGGGCCGGGCCTGGGG - Intergenic
1058699480 9:107588642-107588664 CAGGGCATGGGTTGGGGCTGGGG + Intergenic
1060280717 9:122213946-122213968 ACGGGGGTGGGCGGGGCCTGGGG - Intronic
1060855975 9:126915142-126915164 CGGGGCCGGGGCCGTGCCTGCGG + Intronic
1061071188 9:128311669-128311691 CCAGGGATGGGGCTGGCCTGGGG - Intronic
1061193263 9:129094370-129094392 CCTGGCAGCGGCTGGGCCTGGGG + Intergenic
1061204718 9:129156316-129156338 CCGGGCAGAAGCCAGGCCTGGGG - Intergenic
1061317172 9:129803493-129803515 CCTGGCACGGACCGGGCCCGTGG + Intronic
1061415448 9:130444841-130444863 CCAGGCGGGGGCCGGGCCCGGGG + Intergenic
1061472184 9:130835376-130835398 CCGGGCCTGAGCCGGGCCCGCGG + Intronic
1061574355 9:131496844-131496866 CGGGGCCTGGGATGGGCCTGTGG - Exonic
1061987136 9:134136303-134136325 CCGGGGCTGGGCCTGGCCCGAGG - Intronic
1062031161 9:134362623-134362645 CTGGGCATGGGCTGGGCACGGGG + Intronic
1062044702 9:134419620-134419642 CAGGGCCTGGGCGGGTCCTGTGG + Intronic
1062048267 9:134434311-134434333 GCTGGCATGGGCTGGGCCTGGGG - Intronic
1062344659 9:136109272-136109294 GAGGGCATGGGGCAGGCCTGGGG - Intergenic
1062390411 9:136331520-136331542 CCAGCCCTGGGCCAGGCCTGGGG + Intronic
1062565800 9:137163470-137163492 CGGGGCCGGGGCGGGGCCTGCGG - Intronic
1203469115 Un_GL000220v1:108541-108563 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1203476936 Un_GL000220v1:152513-152535 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1186455016 X:9703900-9703922 CAGGGCATGGTCCAGCCCTGTGG + Intronic
1190108032 X:47573076-47573098 CAGGGCTGGGGCTGGGCCTGGGG - Intronic
1190337265 X:49270031-49270053 CCGGCCGTGGGGCGGGCCCGGGG + Exonic
1198210364 X:134510514-134510536 CCGGGGGTGGGCGGGGGCTGGGG + Intronic
1200079015 X:153566370-153566392 GCGGGAATAGGCGGGGCCTGAGG + Intronic
1200109586 X:153733566-153733588 CAGGAGATGGGCAGGGCCTGTGG + Intronic
1200161961 X:154014122-154014144 GTGGGCAGGGCCCGGGCCTGGGG + Exonic