ID: 1202872659

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177979-178001
Sequence GGCATGGGCCGGGCCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1242
Summary {0: 3, 1: 1, 2: 8, 3: 138, 4: 1092}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872643_1202872659 6 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872644_1202872659 -1 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872638_1202872659 19 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872649_1202872659 -10 Left 1202872649 14_GL000225v1_random:177966-177988 CCCTCCGAGCCCGGGCATGGGCC No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092
1202872639_1202872659 18 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG 0: 3
1: 1
2: 8
3: 138
4: 1092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872659 Original CRISPR GGCATGGGCCGGGCCTGGGG TGG Intergenic
900014181 1:137410-137432 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
900014194 1:137442-137464 GGCAAGGGCGGGGCCTGCAGAGG + Intergenic
900014622 1:139371-139393 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
900014635 1:139435-139457 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
900044044 1:492612-492634 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
900044489 1:494573-494595 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
900044502 1:494637-494659 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
900065454 1:727518-727540 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
900065893 1:729479-729501 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
900065906 1:729543-729565 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
900109286 1:998819-998841 GGCGTCGGGCGGGCCCGGGGGGG - Intergenic
900119073 1:1040974-1040996 GGCAGGGGCGGGGCCCGGCGGGG + Intronic
900127549 1:1075287-1075309 GGCCTGGGCCGGACCTGAGCTGG + Intergenic
900342277 1:2194793-2194815 GGCGGGGGCGGGGCCTGGAGGGG - Intronic
900346882 1:2214373-2214395 GGGATGGGCAGGGCCTGGGAGGG + Intergenic
900374077 1:2345370-2345392 GGCATGGGCCGGCCTTGTTGGGG + Intronic
900391076 1:2434208-2434230 GGCGGGGGCCGCGCCTGGGCAGG + Intronic
900407614 1:2499397-2499419 GGCAGGGGCATGGCCTGTGGGGG + Intronic
900486012 1:2923159-2923181 GGCCTGGGCAGGGCTGGGGGAGG - Intergenic
900525461 1:3126335-3126357 GGCATGGGAGAGACCTGGGGAGG - Intronic
900527015 1:3134370-3134392 GGCATGGCACGGGCATGGGCTGG + Intronic
900592127 1:3464837-3464859 GGCAGGAGCTGGGCCTGAGGAGG - Intronic
900629323 1:3625278-3625300 GGCAGGGGCCAGGGCCGGGGCGG + Intronic
900653308 1:3742013-3742035 GGCTTGGGCCGGGACTGACGTGG - Intergenic
900658777 1:3772742-3772764 CGCAGGGGCCGGGCCTGGGCAGG - Intergenic
900983314 1:6058881-6058903 GGCTTGGGTCGGGGCTGGGAGGG + Intronic
901019755 1:6249691-6249713 AGCGGGGGCCGGGCCCGGGGCGG + Exonic
901242818 1:7704795-7704817 GGGCTGGGCCGGGCCGGGCGGGG + Intronic
901303694 1:8217380-8217402 GGAAGGGGCCGGGGCCGGGGCGG + Intergenic
901796257 1:11681185-11681207 GGAATGGGCGTGGCCTGGGCGGG - Exonic
901845557 1:11980139-11980161 GGCGTCGGCCGGAGCTGGGGGGG - Intergenic
902079477 1:13811484-13811506 GACAGGGGCCGGGCCTGGGGAGG + Intronic
902099628 1:13975245-13975267 GGCAGGAGTGGGGCCTGGGGAGG + Intergenic
902195312 1:14793890-14793912 GGCGAGGGCACGGCCTGGGGAGG - Intronic
902359458 1:15934399-15934421 GGCATTGACTGTGCCTGGGGCGG - Exonic
902378502 1:16041662-16041684 GGCATGGGAAGGGGCTGTGGGGG + Intergenic
902896948 1:19485590-19485612 GGCCCGGGCCGGGCCGGGGCGGG - Intergenic
903024530 1:20417961-20417983 GGAGTGGGCCAGGGCTGGGGAGG + Intergenic
903034542 1:20485675-20485697 GGCGGGGGCCGGGCCGGGCGGGG + Exonic
903261456 1:22133817-22133839 GGCACGGGCCGGGCTCGGGGAGG - Intronic
903263615 1:22143660-22143682 GGGAGGGGCCGGGCGGGGGGCGG - Intronic
903325705 1:22567448-22567470 GGCGTGGGGCCGGCTTGGGGAGG + Intronic
903330971 1:22597224-22597246 GGCCTGGGATGGGTCTGGGGTGG - Intronic
903648839 1:24910930-24910952 GGGATGGGTGGGGCCTGGAGCGG + Intronic
903649548 1:24914445-24914467 GGCGGGTGCCGGGCCTGGGGTGG + Intronic
903777102 1:25800228-25800250 GCCATGGGCCGGGCCCGGCCGGG + Exonic
903778589 1:25808286-25808308 GGCCTGGGCTGCGCCTGGGTGGG + Intronic
903811946 1:26039461-26039483 GGCATGAGCCAGGTCTGGGCTGG - Intronic
903931640 1:26865465-26865487 GGCCTGGGCCGGGCCGGCCGCGG + Intergenic
904239417 1:29134376-29134398 GGGTTGGTCCGGGCCTCGGGAGG - Intergenic
904282902 1:29433690-29433712 GGCAGGGCCCAGGCCTGGGGTGG - Intergenic
904467818 1:30718592-30718614 GGCAGGGGCGGGGCCGGGGGGGG - Intronic
904918303 1:33986075-33986097 GGCATTGGGCTGGACTGGGGTGG - Intronic
905031204 1:34885569-34885591 GGCTTGGGGCTGGCCCGGGGCGG + Exonic
905221447 1:36450649-36450671 GGCGAGGGCCGGGCCAGGGCTGG + Intergenic
905462201 1:38129208-38129230 GGCCTTGGCCGGGCCTGGGGAGG - Intergenic
905627174 1:39496747-39496769 GGCGGGGACCTGGCCTGGGGTGG - Intronic
905693303 1:39957967-39957989 CCCATGGGCTGGGCCTTGGGTGG + Intronic
906525385 1:46490488-46490510 GCCCTGGGCGGGGGCTGGGGAGG + Intergenic
906611705 1:47208481-47208503 GGCGTGGACAGGGACTGGGGAGG - Intergenic
906641873 1:47445804-47445826 GGCGTGGGCCGGGGTGGGGGTGG - Intergenic
906684966 1:47757380-47757402 GGGATGGGCTGGGCTTGGAGGGG - Intergenic
907046619 1:51303566-51303588 GGCATAGGTGGGGCCTGGGAAGG + Intronic
907395980 1:54190140-54190162 GGCAGGGGTGGGGACTGGGGTGG + Intronic
907673558 1:56498432-56498454 GGCTGGGGCTGGGCCTGGGGCGG - Intronic
911664755 1:100539750-100539772 GGCAGGGGCTGGGCCTGCGCCGG - Exonic
912460662 1:109828759-109828781 GGGATGGGGCGGGTGTGGGGAGG + Intergenic
912473986 1:109924231-109924253 GGCAGGGGCAGAGCCTGGCGGGG + Intronic
912520327 1:110240585-110240607 GGCCTGTGCCGGGCGTGGGGAGG - Intronic
912864989 1:113248658-113248680 GGTATGGGTGGGGCCTGTGGTGG + Intergenic
913194526 1:116444659-116444681 GGGCTGGGCTGGGCCTGGGTTGG - Intergenic
913213193 1:116598742-116598764 GGCATGGGCTGGGCGAGGGAAGG + Intronic
913217887 1:116635809-116635831 GGCATTGGCTGGGTGTGGGGTGG - Intronic
914001656 1:143699703-143699725 GGCATGGGGCGGGGTGGGGGTGG - Intergenic
914947680 1:152080750-152080772 GGCATGGCCAGGACCTGCGGCGG + Intergenic
915908926 1:159900213-159900235 GGGAGGGGCGGGGCCGGGGGCGG - Intergenic
915911578 1:159918775-159918797 GGCAGGGGCAAGGCCTGGGGTGG + Exonic
917080423 1:171252234-171252256 GGCAGGGGCAGGGCCTGGGGTGG - Intronic
917537914 1:175887874-175887896 GTCAGGGGCTGGGCCTGAGGAGG + Intergenic
917846660 1:179025933-179025955 GGGAATGGCCGGGCCGGGGGTGG + Exonic
917976952 1:180245862-180245884 GGCATGGGCAGGACACGGGGTGG - Intronic
918208517 1:182330551-182330573 GGGATGGGAGGGGCCAGGGGTGG - Intergenic
919101827 1:193105443-193105465 GGCGGGGGCCGGGCCGGAGGAGG - Intronic
919621202 1:199866297-199866319 GGGATGGGGCGGGGCTGGGGAGG - Intergenic
920033195 1:203049445-203049467 GGCAGGGGCAGGGCCAGGAGGGG - Intronic
920051229 1:203166204-203166226 GGGCTGGGCAGGTCCTGGGGAGG + Exonic
920286292 1:204882218-204882240 GGCATGGCCAGGGGTTGGGGTGG - Intronic
920311233 1:205049645-205049667 GGCAGGGTGCTGGCCTGGGGAGG - Intronic
920805609 1:209231553-209231575 GGCAGGGGCCGGGCCGGGCCGGG - Intergenic
920845845 1:209592443-209592465 GACATGAGCCGGCCCTGGGGAGG + Intronic
920854902 1:209654261-209654283 GGCTTGGGCAGGTCCTGGAGTGG + Intergenic
921159755 1:212464526-212464548 GGCAGGGGCTGAGCCTGGTGAGG - Intergenic
922100481 1:222474031-222474053 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
922100927 1:222476377-222476399 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
922101018 1:222476828-222476850 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
922116347 1:222617993-222618015 GGCTGGGGCGGGGGCTGGGGCGG - Intergenic
922208263 1:223467659-223467681 GGCAGGGGCCTAGCCAGGGGTGG - Intergenic
922262117 1:223951966-223951988 GGCACAGGCTGGGCCTGGAGGGG + Intergenic
922262130 1:223952030-223952052 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
922505519 1:226123382-226123404 GGCTTGGGGAGGGCCTGGAGAGG - Intergenic
922533812 1:226364980-226365002 GGTATGTGCCTGGCCTGGCGAGG - Exonic
922725701 1:227922097-227922119 GGCAGGGCCTGGGCCTGGGTGGG - Intronic
922731837 1:227952592-227952614 GGGATGAGCCTGGCCTCGGGGGG - Intergenic
922733588 1:227967780-227967802 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
922733691 1:227968295-227968317 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
922734408 1:227971672-227971694 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
922734697 1:227972804-227972826 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
922800372 1:228362233-228362255 GGCAGAGCCAGGGCCTGGGGTGG + Intronic
923008944 1:230073109-230073131 GGGATAGGCTGGGCCTGGCGGGG + Intronic
923631159 1:235650107-235650129 GGCGCGGGCCCGGGCTGGGGCGG - Intronic
924179203 1:241424224-241424246 AGCGGGAGCCGGGCCTGGGGCGG + Intergenic
924186630 1:241498450-241498472 GGCGCAGGCAGGGCCTGGGGAGG + Intronic
924343507 1:243054985-243055007 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
924343518 1:243055017-243055039 GGCAAGGGCGGGGCCTGCAGAGG + Intergenic
924343851 1:243056494-243056516 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
924343944 1:243056945-243056967 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
924343957 1:243057009-243057031 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
924384553 1:243489311-243489333 GCCATGGGCCCGTCCTGGTGAGG + Intronic
1062843679 10:689385-689407 GGCGGGGGCCGGGCCCGGAGGGG - Intronic
1062874022 10:931299-931321 GGGCAGGGCCGGGCCTGGGCCGG - Intronic
1063115074 10:3067384-3067406 GGCAGGGGCCGGGGCTGGGGCGG - Intronic
1063429715 10:5977740-5977762 CGCATGGGCCGTGCCCGGTGGGG + Intronic
1063663484 10:8048934-8048956 GGCCGGGGCCGGGCTGGGGGCGG + Intergenic
1064203371 10:13302407-13302429 CGCAAGCGCAGGGCCTGGGGCGG + Intronic
1064452856 10:15458974-15458996 GGCATGGCCAGGTTCTGGGGAGG - Intergenic
1064805255 10:19122980-19123002 GGCATGGGCTGGCCTTTGGGAGG - Intronic
1065727235 10:28677793-28677815 GGCATGGGCCCTGCCCGGAGCGG - Exonic
1065764037 10:29009709-29009731 AGCATGGTCAGGGGCTGGGGAGG + Intergenic
1065925510 10:30431799-30431821 AGCCTGGGCCGGGGTTGGGGAGG - Intergenic
1066690763 10:38025564-38025586 AGCATGGCCAGGGCCTGGTGAGG - Intronic
1066732376 10:38448054-38448076 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
1066732608 10:38449119-38449141 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1067001974 10:42624041-42624063 AGCATGGCCAGGGCCTGGTGAGG + Intronic
1067044483 10:42976498-42976520 GGCAGGGGTGGCGCCTGGGGTGG + Intergenic
1067077207 10:43194959-43194981 GGGAAAGGCTGGGCCTGGGGAGG - Exonic
1067168389 10:43883583-43883605 GGCATGGGTCTGGGCCGGGGAGG + Intergenic
1067455048 10:46413116-46413138 GGCATGGGGTGGGCCTTGGTTGG + Intergenic
1067632156 10:47971518-47971540 GGCATGGGGTGGGCCTTGGTTGG - Intergenic
1067686111 10:48466766-48466788 CTCAGGGTCCGGGCCTGGGGCGG - Intronic
1067784686 10:49236869-49236891 GGAAGGGGCAGGGCCTGGGCAGG - Intergenic
1069564003 10:69451360-69451382 GGGAGGGGGCGGGCCAGGGGCGG - Intergenic
1069889410 10:71643885-71643907 GGCAGGGGTTGGGCTTGGGGAGG + Intronic
1070130979 10:73655361-73655383 GGCATGGGCAGGGCAGGGTGAGG + Intronic
1070146949 10:73781706-73781728 GGCATAGGGCGGGGTTGGGGGGG - Intergenic
1070151973 10:73811044-73811066 GGCCGGGCCCGGGCTTGGGGAGG + Intronic
1070414391 10:76175998-76176020 GGAATGAGCCGGGCCTGGAGAGG + Intronic
1070610017 10:77926641-77926663 GCCATGGGCCGGGGCCTGGGCGG + Intergenic
1070931636 10:80265000-80265022 GGTCCGGGGCGGGCCTGGGGCGG + Intergenic
1072758375 10:98036085-98036107 GGCAGGGCCAGGGTCTGGGGAGG - Intergenic
1072809367 10:98447023-98447045 GGCATGGGCAAGGCCTGGCAGGG - Intergenic
1073403682 10:103278282-103278304 GGCCGGGGCTGGGCGTGGGGAGG + Intronic
1073468002 10:103705302-103705324 GGCGTGGGCCAGGCCTTGGTGGG + Intronic
1074126079 10:110530115-110530137 GGGGTGGGGCGGGGCTGGGGGGG - Intergenic
1074169714 10:110919942-110919964 GGCCGGGGCCGGGCCTGCGGCGG + Intronic
1074772428 10:116742623-116742645 GGCCGGGGCGGGGCCCGGGGAGG - Intergenic
1074976648 10:118586932-118586954 GGGATGGGGCCAGCCTGGGGTGG - Intergenic
1074976659 10:118586956-118586978 GGGATGGGGCCAGCCTGGGGTGG - Intergenic
1074976670 10:118586980-118587002 GGGATGGGGCCAGCCTGGGGTGG - Intergenic
1075085837 10:119413888-119413910 GGCCTGGGCGGGGGCAGGGGTGG - Intronic
1075129472 10:119726001-119726023 GGGTGGAGCCGGGCCTGGGGCGG + Intergenic
1075323197 10:121508948-121508970 GGCTTGGCCCGGTCCTGGGCAGG + Intronic
1075689559 10:124386263-124386285 GCCATGGGCAGGGCCTGGTCTGG + Intergenic
1075885392 10:125895938-125895960 GGCATGGGCCGGGCCTGGGGCGG - Intronic
1075971295 10:126655903-126655925 TGCATGCCCTGGGCCTGGGGGGG + Intronic
1076096366 10:127737311-127737333 GGCCTGGGCCTGGCCGGGCGGGG - Exonic
1076542619 10:131223831-131223853 GGCAGGGGGAGGGCCAGGGGAGG - Intronic
1076727099 10:132419110-132419132 GGCTGGGGCTGGGCTTGGGGAGG - Intergenic
1076749968 10:132537692-132537714 GGGTGGAGCCGGGCCTGGGGCGG - Intergenic
1076970379 11:129087-129109 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
1076970392 11:129119-129141 GGCAAGGGCGGGGCCTGCAGAGG + Intergenic
1076970818 11:131048-131070 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
1077041684 11:527428-527450 GCCGTGGGCAGGGGCTGGGGAGG - Intergenic
1077075974 11:702352-702374 GGCCTGGGCCTGCCCTGAGGTGG + Intronic
1077096734 11:802173-802195 GGCATGGACAGGGCGTGGCGGGG - Exonic
1077101949 11:826283-826305 GGCTGGGGCTGGGGCTGGGGAGG + Intronic
1077105896 11:842560-842582 GCCCGGGGCGGGGCCTGGGGGGG - Intergenic
1077121505 11:910947-910969 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
1077160358 11:1109808-1109830 GGCTGAGGCCGAGCCTGGGGAGG + Intergenic
1077165253 11:1131897-1131919 GGCAGGGGCTGGGGCTGGGCTGG - Intergenic
1077183583 11:1226947-1226969 GACCTGGGCCAGGGCTGGGGGGG + Intronic
1077218119 11:1403519-1403541 GGGATGGGCAGGGGCTGCGGAGG + Intronic
1077220389 11:1413082-1413104 GGGCTGGGCAGGGACTGGGGTGG + Intronic
1077220576 11:1413731-1413753 GGCCTGAGCTGAGCCTGGGGTGG + Intronic
1077353821 11:2105537-2105559 TGCTTGGGCTGGGCCTGGGGAGG - Intergenic
1077360419 11:2138185-2138207 GGCCGGGGCCGGGGCTGGGGCGG - Intronic
1077367279 11:2166313-2166335 GGCATAGGGCGGGGCTGGAGCGG - Intronic
1077391292 11:2301789-2301811 GTCATGGGCAGGACCTGGTGTGG - Exonic
1077434133 11:2530371-2530393 GCCATGGGGCGGGTCTGTGGGGG + Intronic
1077483174 11:2826100-2826122 GGCATGAGCCAGGCCTGGTTAGG - Intronic
1077487844 11:2847231-2847253 CTCATGGGCAGGGCCTGGGGTGG - Intronic
1077609590 11:3636118-3636140 GGCAGGGGCTGTGCCTGGGGAGG + Intergenic
1077637839 11:3855627-3855649 GGCGCGGGGCGGGCCCGGGGCGG - Intronic
1077675062 11:4187826-4187848 GGCCTGAGCGGGGGCTGGGGTGG + Intergenic
1077806492 11:5596083-5596105 GGAAGGGGCGGGGCCTGGGGAGG - Intronic
1078190846 11:9091625-9091647 GGGCGGGGCCGGGCCGGGGGTGG - Intronic
1078191120 11:9092871-9092893 GGCATGTTCGGGGGCTGGGGTGG - Intronic
1078594451 11:12674570-12674592 GGCGGGGCCCGGGCCCGGGGCGG + Exonic
1080595968 11:33774524-33774546 GGCAGGGGCGGGGCCAGGGCGGG - Intronic
1081730683 11:45369765-45369787 GGCTCGGGTCGGGCCAGGGGTGG + Intergenic
1082001281 11:47394924-47394946 GCAATGGGCCGGGGGTGGGGAGG - Intergenic
1082002369 11:47400253-47400275 GCCGGGGGCCGGGCCTGCGGCGG - Intergenic
1082029529 11:47594337-47594359 GCCAGGGGCCGGGCGTGGGGAGG + Exonic
1082260331 11:50072929-50072951 GGCAGGGGCTGGGCCTGGAGAGG + Intergenic
1082260687 11:50074528-50074550 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
1082261093 11:50076710-50076732 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1082261123 11:50076868-50076890 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1082261299 11:50077799-50077821 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
1083163504 11:60869730-60869752 GGCATGGCCAGAGCCTTGGGAGG - Exonic
1083305838 11:61761559-61761581 GGCAGGGGCAGGACCTGGAGGGG + Intronic
1083329660 11:61891611-61891633 GGCCGGGGCCTGGCCGGGGGCGG - Intronic
1083418088 11:62538212-62538234 GGCTTGGGCGGTGCCTGGTGGGG - Intronic
1083419593 11:62545675-62545697 GGCAGGAGCCGGGCTTGGCGTGG - Intronic
1083437410 11:62652367-62652389 GGGATGGGGCGGGGCGGGGGTGG - Intronic
1083603446 11:63962601-63962623 GGAGAGGGCCAGGCCTGGGGTGG + Intergenic
1083609674 11:63998918-63998940 GGCAGGGGCGGGCCGTGGGGCGG + Intronic
1083764478 11:64835455-64835477 GGGAGGGGCCGGGCCTGGCCTGG - Intronic
1083934720 11:65864245-65864267 GCCATGTGCCGGCCCAGGGGAGG + Intronic
1083967525 11:66051842-66051864 GGCCTGGGCCGGGGGTGGGCGGG + Intronic
1084000258 11:66292105-66292127 GGCCGGAGCCGGGCCTGGGGCGG + Intronic
1084028397 11:66466930-66466952 GGGATGGGCCCGGCCCGCGGCGG - Exonic
1084270501 11:68026920-68026942 GGCTGGGGCTGGGGCTGGGGAGG - Intronic
1084276216 11:68052219-68052241 GGCCAGGGCCGGGCCCAGGGTGG + Intergenic
1084499902 11:69529333-69529355 TCCATGGGCCGGGCCTGGACAGG - Intergenic
1084599299 11:70135481-70135503 GGGATGGGCAGAGCGTGGGGTGG - Intronic
1084641658 11:70429955-70429977 TGCAGGGGCAGGGCCTGGGGTGG - Intronic
1084787662 11:71452987-71453009 CGCAAGGGCCGGGCCGGGGCCGG + Intergenic
1084889762 11:72230903-72230925 GGCCCGGGCTGGGGCTGGGGCGG + Intronic
1084952977 11:72676931-72676953 GGCCGGGGCGGGGCCTGCGGCGG - Intergenic
1085053336 11:73390819-73390841 GGCATGGGGCTGGCATGGGCTGG - Exonic
1085698582 11:78726721-78726743 GGCAGGAGCAGGACCTGGGGTGG - Intronic
1087127300 11:94640684-94640706 GGCAGGGGCGGGGCGGGGGGTGG - Intergenic
1087309469 11:96522879-96522901 AGCTTGGGCAGGGCCTGGGCAGG + Intergenic
1088604480 11:111514728-111514750 GGCAGGGGCGGGGCGGGGGGAGG + Intergenic
1088797686 11:113277604-113277626 GGCATGGGCTTGGCCTGGTGTGG - Exonic
1089199577 11:116715651-116715673 GACAGGGGCTGGGCCTGGGGTGG + Intergenic
1089330612 11:117686497-117686519 GGCAGGGACCAGGGCTGGGGAGG - Intronic
1089388039 11:118080608-118080630 GGCATGGGTCTGGGCTAGGGAGG - Intronic
1089616385 11:119697042-119697064 GGCAGAGGCCGGGCCTGGGAGGG + Intronic
1089616549 11:119698079-119698101 GGCAGGGCCTGGGCCTGGGCAGG - Intronic
1089647002 11:119886930-119886952 GGCCTGGGCATGGCCTGGGGAGG - Intergenic
1089694865 11:120210868-120210890 GGCGTTGGCCGGGCAGGGGGCGG - Exonic
1089782647 11:120884451-120884473 GGCATGGGCCGGTCTTTGCGTGG - Intronic
1090178606 11:124673756-124673778 GGCAGGGGCGGGGCCTGGGCGGG + Exonic
1090238148 11:125164589-125164611 GGCAGCGGCCGGGCCGGGAGTGG + Intergenic
1090632401 11:128661304-128661326 GGGATGGGCTGGACCTGTGGGGG + Intergenic
1091284426 11:134400150-134400172 GGCAGGGGCAGGGCCAGGGAAGG - Intronic
1091356899 11:134944246-134944268 GGCAGGGGCTGGGGCTGGGGAGG + Intergenic
1091434024 12:459913-459935 GGCGGGGGCGGGGCCGGGGGCGG + Intergenic
1091792772 12:3281124-3281146 GGCAGGGGAAGGCCCTGGGGAGG + Intronic
1092229021 12:6766675-6766697 GGCCGGGGCCGGGGCTGGCGGGG - Exonic
1092526926 12:9315121-9315143 GCAGTGGGCGGGGCCTGGGGTGG + Intergenic
1092540348 12:9416659-9416681 GCAGTGGGCGGGGCCTGGGGTGG - Intergenic
1093746042 12:22742053-22742075 GGTATGGGCCGGGGACGGGGAGG - Intergenic
1095986985 12:48005244-48005266 GGCAGGGGCAGGCCCTGGGAAGG + Intergenic
1096073201 12:48787480-48787502 GGGATGGGCAGTGCCTGGAGTGG - Intronic
1096094397 12:48925008-48925030 GGCCGGGGCGGGGCCTGGGAGGG - Intronic
1096626612 12:52899753-52899775 GGTATGGGCCGGGTTGGGGGTGG - Exonic
1096796762 12:54082602-54082624 GGCCGGGGCCGGGCTGGGGGAGG + Intergenic
1096847485 12:54415757-54415779 AGCATGGGCCAGGCCAGAGGAGG + Intronic
1097166467 12:57088972-57088994 GGCGTGGGCAGAGCCGGGGGCGG - Exonic
1097167663 12:57094237-57094259 GGCCTGGGAGGGGCCTGGGAGGG + Intronic
1097187268 12:57202570-57202592 GACAAGGGCCAGGCCTGGGAGGG - Intronic
1097190252 12:57216378-57216400 GGGACGGGCGGGGCCTCGGGCGG - Intergenic
1102501822 12:113358530-113358552 GCCATGGGCGGGGCCGAGGGCGG - Intronic
1102899334 12:116624243-116624265 GGCATGGGCAGGCTCTGGTGAGG - Intergenic
1103090604 12:118095498-118095520 GGCAGGGACCGGGGCTGGAGAGG - Intronic
1103557537 12:121775421-121775443 GGCTTGGGCAGGGCCTGGGAAGG - Intronic
1104001625 12:124863954-124863976 GGCAGGGGCGGGGCCTGAGCGGG + Intronic
1104376191 12:128267108-128267130 GGCGGGGGCGGGGCCGGGGGCGG + Intergenic
1104623803 12:130337547-130337569 GGCGGGGGCGGGGCCTGTGGGGG + Intergenic
1104900919 12:132189149-132189171 GGGATGGGGTGGGCGTGGGGGGG + Intergenic
1104901062 12:132189761-132189783 GTCGAGGGCGGGGCCTGGGGCGG + Intergenic
1104910445 12:132237824-132237846 GGCATCTGCCAGGCCTGCGGTGG + Intronic
1105639701 13:22249766-22249788 GGGATGGGGCGGGCCATGGGTGG - Intergenic
1105699576 13:22926353-22926375 GGCCTGGGCCGGGGCGGGGCGGG + Intergenic
1105817727 13:24051904-24051926 GGGGTGGGCCGGGGCTGAGGAGG - Intronic
1105975467 13:25468765-25468787 GGCGTGGGCGGGGCCGGGGGCGG + Intronic
1106340124 13:28819813-28819835 GGCTGGGGCTGGGGCTGGGGCGG + Intergenic
1106527251 13:30552070-30552092 GCCATGGGCAGGGGTTGGGGAGG - Intronic
1107250033 13:38349472-38349494 GGCCGGGGGCGGGGCTGGGGCGG - Intergenic
1107364515 13:39655920-39655942 GGGCTGAGCCGGGCCAGGGGCGG + Intronic
1108292718 13:48976593-48976615 GGCGGGGGCGGGGGCTGGGGCGG + Exonic
1108350349 13:49585656-49585678 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1109267641 13:60219410-60219432 GGCTTAGGCCAGGCATGGGGAGG - Intergenic
1111658299 13:91178822-91178844 GGCATGGGCTGGTGCTGGGGAGG + Intergenic
1112216300 13:97434264-97434286 GGCATGGGCCGGGCCGAGCCGGG - Exonic
1113513670 13:110874649-110874671 GGGATGGGCCGGGGCGGGTGAGG - Intergenic
1113543076 13:111123868-111123890 GGCAGGGGGCGGGGCCGGGGGGG - Intronic
1113664857 13:112134443-112134465 GGCATGGCAGGGGCCTGTGGAGG + Intergenic
1113741565 13:112715446-112715468 GGGATGGGCCAGGTGTGGGGAGG - Intronic
1113762544 13:112859598-112859620 GTGAAGGGTCGGGCCTGGGGAGG + Intronic
1113923787 13:113929274-113929296 GGCCTGGGCCAGCCCTGAGGAGG - Intergenic
1113962276 13:114132655-114132677 AGCAGGGGCCGGGCCGCGGGCGG - Intergenic
1114259145 14:21025104-21025126 GGGCTGGGGCGGGCCGGGGGCGG - Intronic
1114270713 14:21098434-21098456 GGCGGGGGCCGGGCCGGGGGCGG - Exonic
1114558588 14:23576297-23576319 GGCAAGGGCAGGGGCGGGGGTGG + Exonic
1114636193 14:24188324-24188346 GAGGTGGGCTGGGCCTGGGGTGG - Exonic
1116905192 14:50396968-50396990 GGGCTGGGCCGGGCCGGGGGTGG - Intronic
1117066096 14:52014417-52014439 GGCGTGGGCCGGACCATGGGTGG + Exonic
1119231696 14:72984996-72985018 GGCAAGGGCAGGGCCAGGAGAGG - Intronic
1119731443 14:76953702-76953724 GGCAGGGGCCTGGGGTGGGGCGG + Intergenic
1120426251 14:84351495-84351517 GGAATGGTCCTGGGCTGGGGCGG + Intergenic
1121025763 14:90615310-90615332 GGCCTGTGCAGAGCCTGGGGTGG + Intronic
1121050533 14:90816554-90816576 GGCAGGGGCGGGGGCTAGGGCGG + Intergenic
1121124087 14:91394906-91394928 GCCAGGGGACGGGCCTTGGGTGG + Intronic
1121279888 14:92690668-92690690 GGTATGGCCCAGGCTTGGGGTGG + Intergenic
1122027342 14:98887255-98887277 GGCTAGGGCAGCGCCTGGGGTGG + Intergenic
1122082339 14:99274455-99274477 GTAAGGGGCCGTGCCTGGGGAGG + Intergenic
1122302449 14:100738836-100738858 GGCCGGGGCTGGGCCTGGGAGGG - Intergenic
1122408053 14:101512097-101512119 GGCATGGGGTGGACCTGGGCCGG - Intergenic
1122502841 14:102212674-102212696 GACCTGGGGAGGGCCTGGGGAGG + Intronic
1122558179 14:102592591-102592613 GGCAGGGGCGGGGCCTGCAGGGG - Intergenic
1122783093 14:104151971-104151993 GGCAGGGTCAGTGCCTGGGGAGG - Intronic
1122880735 14:104689514-104689536 GCCGGGGGCGGGGCCTGGGGGGG - Intergenic
1122889014 14:104724153-104724175 GGCAGGGGGCGGGCCGGGGGAGG - Intergenic
1122891765 14:104735289-104735311 TGCATAGCCCGGGCCTGGGCTGG + Intronic
1122903742 14:104792563-104792585 TGCCAGGGCTGGGCCTGGGGAGG - Intronic
1122939272 14:104973966-104973988 GGGATGGGGAGGGGCTGGGGCGG - Intronic
1123049142 14:105532259-105532281 GGCATGGGCCTGGGCAGGGTGGG - Intergenic
1123067605 14:105626428-105626450 GGCATGAGCCGTCCCTGAGGTGG - Intergenic
1123071624 14:105645153-105645175 GGCATGAGCCGTCCCTGAGGTGG - Intergenic
1123091284 14:105743429-105743451 GGCATGAGCCGTCCCTGAGGTGG - Intergenic
1123097058 14:105771769-105771791 GGCATGAGCCGTCCCTGAGGTGG - Intergenic
1123115644 14:105892898-105892920 TGCCTGGCCCGGCCCTGGGGCGG - Intergenic
1202872659 14_GL000225v1_random:177979-178001 GGCATGGGCCGGGCCTGGGGTGG + Intergenic
1125733874 15:41910123-41910145 GGTATGGGTGGGGCCTGGGTGGG + Intronic
1127877169 15:63121777-63121799 GGCAGGGGGCGGGACGGGGGTGG - Intergenic
1128078277 15:64841757-64841779 GGGAGGGGCGGGGCCTGGGTTGG - Intergenic
1128089783 15:64911765-64911787 GTCCTGGTCCGGGACTGGGGTGG + Intronic
1128223019 15:65982130-65982152 GGCTGGGGCGGGGCCTGGAGTGG - Intronic
1128551706 15:68601767-68601789 GGCAGGGCCCAGGCCTGGGAGGG + Intronic
1128561096 15:68668261-68668283 GGCATGGCCCAGGGCTGGGGAGG + Intronic
1128680535 15:69648264-69648286 GGCATGGGCCAGGGCTCCGGGGG + Intergenic
1129034898 15:72642950-72642972 GGAATGGGCCTGGTGTGGGGTGG + Intergenic
1129214984 15:74094266-74094288 GGAATGGGCCTGGTGTGGGGTGG - Intergenic
1129236007 15:74224159-74224181 GGCAGGTGCTGGCCCTGGGGAGG + Intergenic
1129298928 15:74614726-74614748 GGCATGGGCGGGGCCGCGGCTGG + Intronic
1129390383 15:75217333-75217355 GGAATGGGCCTGGTGTGGGGTGG + Intergenic
1129446865 15:75625190-75625212 AGCGTGGGCGGGGCCTGGGGCGG - Intronic
1129473888 15:75770271-75770293 GGAATGGGCCTGGCATGGGGTGG - Intergenic
1129614489 15:77087456-77087478 GGAATGAGCCTGGCCTTGGGAGG + Intergenic
1129732128 15:77938628-77938650 GGAATGGGCCTGGTGTGGGGTGG - Intergenic
1130076680 15:80695593-80695615 AGCCTGGGCCGGGGCCGGGGCGG - Exonic
1130335042 15:82951494-82951516 GGGATGGGTGGGGCCTGGGAAGG - Intronic
1131002629 15:88950900-88950922 AGCATGGGCCTGTCCTGTGGGGG - Intergenic
1131094140 15:89645480-89645502 GGCTGGGGCAGGGGCTGGGGAGG - Intronic
1131144316 15:90001636-90001658 GGCTGGGGCTGGGGCTGGGGCGG - Intronic
1131248046 15:90813040-90813062 AGCTTAGGCCTGGCCTGGGGAGG + Intronic
1132011040 15:98276918-98276940 GGCATGGTCAGGTTCTGGGGAGG - Intergenic
1132273250 15:100544629-100544651 GGCAGGTGCGGGGCCCGGGGCGG - Exonic
1132464743 16:72364-72386 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1132497735 16:271643-271665 GGCAGGGGCTCAGCCTGGGGAGG - Intronic
1132498776 16:275736-275758 GGGGCGGGGCGGGCCTGGGGCGG - Intronic
1132499819 16:280365-280387 GGCACGGGCCGGGCGGGCGGCGG + Intronic
1132553194 16:561537-561559 GGCAGGGGCTGGGCCAGGAGAGG - Intronic
1132556209 16:573827-573849 GGGCTGAGCTGGGCCTGGGGTGG + Intronic
1132604575 16:788411-788433 GGCCGGGGGCGGGCCGGGGGGGG - Intergenic
1132651468 16:1023105-1023127 GGGGCGGGCCGGGCCTAGGGAGG + Intergenic
1132683454 16:1153028-1153050 GGCCGGGGCGGGGCCGGGGGCGG - Intergenic
1132683853 16:1154149-1154171 GGCGTGGGCCGGGCGCGCGGGGG + Intronic
1132743832 16:1428655-1428677 GGAATGGCCGGGGCCTGCGGAGG - Intergenic
1132769519 16:1553496-1553518 GGCGTGGCCGGAGCCTGGGGAGG + Intronic
1132858051 16:2056257-2056279 GAAATGGGCCGGCCCTGGGGAGG - Intronic
1132885852 16:2181646-2181668 GGCAGGGGCCGGGCTAGGGGCGG + Intronic
1132925966 16:2429304-2429326 GACATGGGCGGGGCCGGCGGCGG + Intergenic
1133020504 16:2964830-2964852 GGCAAAGGCAGGGCCTGGGGAGG - Intronic
1133138641 16:3729194-3729216 GGGCTGGGCCGGGGGTGGGGGGG + Exonic
1133222529 16:4324953-4324975 GGCAGGGGCAGGGCCTGCTGGGG - Intronic
1133246363 16:4451380-4451402 GGCAGGGGCAGGGGCTGGGATGG + Intronic
1133334916 16:5000775-5000797 GCCTGGGGCCGGGCCTGGGAAGG + Intronic
1133741992 16:8658832-8658854 GGCAGGGGCCAGGCCTTGGAGGG - Intergenic
1133802101 16:9092310-9092332 GGCCGGGGCCGGGCCCGGGCGGG - Intronic
1134094469 16:11410596-11410618 GGCCTGGGCCAGGGCTGGGAGGG + Intronic
1134522172 16:14923814-14923836 GGGATGGGGCGGGGCGGGGGCGG + Intronic
1134569446 16:15278973-15278995 GGCATGGTCAGGGTCTGGTGAGG + Intergenic
1134709842 16:16322465-16322487 GGGATGGGGCGGGGCGGGGGCGG + Intergenic
1134732931 16:16477076-16477098 GGCATGGTCAGGGTCTGGTGAGG - Intergenic
1134934508 16:18234895-18234917 GGCATGGTCAGGGTCTGGTGAGG + Intergenic
1134949761 16:18346180-18346202 GGGATGGGGCGGGGCGGGGGCGG - Intergenic
1135026944 16:19006031-19006053 GGCAGGGGCAGGGCCAGGTGGGG - Intronic
1135335799 16:21599904-21599926 GGCTGGGGCCGGGGCCGGGGCGG + Intronic
1135405003 16:22191172-22191194 GGGGTGGGCCGGGACTGGGCAGG - Exonic
1135521630 16:23182662-23182684 GGTGGGGGCGGGGCCTGGGGAGG + Intergenic
1135555996 16:23437043-23437065 GGCTTGGGCCAGGCATGGGAGGG + Intronic
1136171819 16:28494539-28494561 GCCGTGGGCAGGGCCTGGGGTGG + Intronic
1136188508 16:28601715-28601737 GGCAGGGCCCAGGCCTGGCGCGG - Intergenic
1136190976 16:28614709-28614731 GGCAGGGCCCAGGCCTGGCGCGG - Intronic
1136399285 16:30009162-30009184 GTCATGGGCTGGGCCGGGCGGGG + Intronic
1136419562 16:30123252-30123274 GGAAGGGGCGGGGCCTCGGGCGG - Exonic
1136524555 16:30820788-30820810 GGGATGGGGAGGGCCTGGGGTGG - Intergenic
1136871036 16:33808516-33808538 GGCAGGGGGCGGGCCTGGACAGG - Intergenic
1136989904 16:35145672-35145694 GGCATGCACCGGGGTTGGGGGGG + Intergenic
1137350359 16:47708485-47708507 TTTATGGGCCAGGCCTGGGGTGG - Intergenic
1138179874 16:54933690-54933712 GGCCTGGCCCGGGCCCCGGGTGG - Exonic
1138829543 16:60359645-60359667 GGCATGGCCAGGACCTGCGGCGG + Exonic
1139446383 16:67001054-67001076 GGGAGGGGCGGGGCCTGGGGCGG + Intronic
1139446391 16:67001065-67001087 GGCCTGGGGCGGGGATGGGGGGG + Intronic
1139544784 16:67645080-67645102 GGGAGGGGCCGGGCCGGGGGCGG + Exonic
1139784960 16:69385571-69385593 GGTGAGGGCCGGGCCGGGGGAGG - Exonic
1139826637 16:69762433-69762455 TGCACGGGGCGGGCCGGGGGCGG + Intronic
1140862783 16:79033719-79033741 GCCAGGGGCTGGGCTTGGGGAGG - Intronic
1141068911 16:80935570-80935592 GGCATAGGCAGAGCCTGGTGTGG - Intergenic
1141083751 16:81076956-81076978 GGGAGGGGCGGGGCCTGAGGAGG - Intronic
1141125492 16:81397968-81397990 GGCAGGGGCCGGGATTGGGTAGG - Intergenic
1141353880 16:83324926-83324948 GACATGGGCTGGGCCTGAAGAGG - Intronic
1141452887 16:84117289-84117311 GGCAGGTGCCCGGCCGGGGGTGG - Intergenic
1141709313 16:85688782-85688804 GGCCTGGGCCCGCCGTGGGGAGG - Intronic
1141888853 16:86912954-86912976 GGCATGGGGCAGGTCTGTGGAGG - Intergenic
1142009306 16:87705786-87705808 GGCCTGGGCGGGGGCGGGGGCGG + Intronic
1142109290 16:88322748-88322770 GGCACGGGGAGGGCCTGGAGTGG - Intergenic
1142114363 16:88348643-88348665 GGTCTGGGCAGGGCCTGGGCTGG - Intergenic
1142147914 16:88500147-88500169 GGCAACGGCGGGGCCTGGGTGGG - Intronic
1142181498 16:88673064-88673086 GCCGTGGGCCGGGCCAGGGGTGG + Intergenic
1142354428 16:89595670-89595692 GGCGTGAGCCTGGCCTGGGAAGG - Intronic
1142449425 16:90166406-90166428 TGCATGAGCTGGGCCTGGTGAGG - Intergenic
1142449432 16:90166438-90166460 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
1142449857 16:90168363-90168385 GGCAAGGGCGGGGCCTGCAGAGG - Intergenic
1142449870 16:90168395-90168417 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1203101136 16_KI270728v1_random:1307542-1307564 GGCAGGGGGCGGGCCTGGACAGG + Intergenic
1142457216 17:63451-63473 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
1142457229 17:63483-63505 GGCAAGGGCGGGGCCTGCAGAGG + Intergenic
1142457658 17:65411-65433 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
1142457671 17:65475-65497 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
1142496109 17:307084-307106 GGGATGGGCCTGCCGTGGGGAGG - Intronic
1142496130 17:307148-307170 GGGATGGGCCTGCCATGGGGAGG - Intronic
1142752385 17:1996843-1996865 GGCCTGGGCAGAGGCTGGGGTGG - Intronic
1143178370 17:4969184-4969206 GGGGAGGGCCGGGCCTGCGGCGG + Exonic
1143400759 17:6640611-6640633 GGCTCGGGCCGGGGCTGGGGGGG - Intronic
1143446881 17:7014972-7014994 GGCGGGAGCCGAGCCTGGGGTGG + Intronic
1143513326 17:7407467-7407489 GGCCTGAGTCTGGCCTGGGGTGG + Intronic
1143575015 17:7787083-7787105 GGCGTGGGCCGGGGCTGGGGAGG + Intronic
1143762851 17:9117313-9117335 GGGAAGGGCCCGGCCTGGGGCGG + Intronic
1144143787 17:12377271-12377293 GGAATGGGCCTGGCCTGGCCTGG - Intergenic
1144269187 17:13601103-13601125 GGCACTGGCCGGGCCCGGAGGGG + Exonic
1144663285 17:17085403-17085425 TGCATGGGGAGGGCCTGCGGGGG - Intronic
1144960742 17:19042645-19042667 GGGCGGGGCCGGGCCTGGGAGGG + Intronic
1144974418 17:19131879-19131901 GGGCGGGGCCGGGCCTGGGAGGG - Intronic
1145018032 17:19411525-19411547 GGGATGGGCCGGGGGTGGGGAGG + Intronic
1145163102 17:20589116-20589138 GGCAGGCGCCGGGCCGGGTGGGG - Intergenic
1145750833 17:27353981-27354003 GGCCCGGGCCGTGGCTGGGGAGG - Intergenic
1145777657 17:27540578-27540600 GGTATGGGCCGGGCCGGGAGAGG + Intronic
1145886444 17:28385298-28385320 GGCTGGGGCTGGGGCTGGGGCGG - Intronic
1145963080 17:28898623-28898645 GGCAGGGCTTGGGCCTGGGGAGG - Exonic
1146398678 17:32487360-32487382 GGTAGGGCCCGGGACTGGGGCGG + Intronic
1146439026 17:32877244-32877266 GGCCAGGGCCGCGGCTGGGGCGG - Intergenic
1147047010 17:37760234-37760256 GGCATGTATCGGGCATGGGGTGG + Intergenic
1147134733 17:38428406-38428428 GGGAGGGGCGGGGCCGGGGGCGG - Exonic
1147149975 17:38509038-38509060 GGCAGGGGCGGGGCGGGGGGCGG + Intronic
1147197705 17:38778729-38778751 CACACGGGCCCGGCCTGGGGAGG + Intronic
1147316935 17:39625519-39625541 GACTTGAGCCAGGCCTGGGGTGG + Intergenic
1147769499 17:42857619-42857641 GGGAGGGGCCTGGCCTGGGTGGG + Exonic
1148032111 17:44628545-44628567 GGCAGGGGCAGGGTCAGGGGAGG + Intergenic
1148085810 17:44993290-44993312 GGGATGGGGCGGGGGTGGGGTGG - Intergenic
1148158349 17:45436190-45436212 GGCAGGAGCCTGGCCTGGGGAGG - Exonic
1148437700 17:47695735-47695757 GGAATGGGCCGGGCCCGGCTGGG + Exonic
1148737582 17:49873470-49873492 GGAATGGGCTGGGGCAGGGGAGG - Intergenic
1149444753 17:56705029-56705051 GGGATGGGCTGGGCCTGGGTGGG - Intergenic
1149477812 17:56978021-56978043 GGCATGGGGCGGGGCCTGGGCGG - Intergenic
1150389770 17:64783599-64783621 GGCAGGAGTCTGGCCTGGGGAGG - Intergenic
1150488896 17:65561311-65561333 GGCGGAGGCCGGGCCTGGAGGGG - Intronic
1150643319 17:66964084-66964106 GGCCTGGCCCGGGCCTGGCGTGG + Intergenic
1151139178 17:71975492-71975514 GGCATTGGCAGGGCCCGGGCTGG - Intergenic
1151344260 17:73492147-73492169 GGCTTGGGCTGGGCTTGGTGGGG - Intronic
1151425818 17:74030464-74030486 GGCATGGGATGGGCCAGGAGAGG - Intergenic
1151495101 17:74454136-74454158 GGCCGGGGCGGGGCTTGGGGTGG - Intergenic
1151683463 17:75633830-75633852 GCCGTGGGCTGGGCCTGGGTTGG - Intronic
1151708426 17:75785092-75785114 GGTCTGGGCCGGGCCGGAGGAGG - Intronic
1151724941 17:75878267-75878289 GGCAGGGGCCGGGCCGGGGCCGG + Exonic
1151744344 17:76003716-76003738 GGTATGGCCCCAGCCTGGGGAGG - Intronic
1151848052 17:76671768-76671790 GGCGTGGGGCGGGCTTGAGGTGG + Intergenic
1151855499 17:76718667-76718689 GGCAAGGGCAGGGCCTGGGGAGG - Intronic
1151938958 17:77281203-77281225 GGCGGGCGCCGGGCCTGGGAGGG - Intronic
1152032448 17:77852847-77852869 GGCGTGGGCAGGAGCTGGGGTGG + Intergenic
1152153151 17:78615658-78615680 GACATGGGTAGGGGCTGGGGAGG - Intergenic
1152331401 17:79675342-79675364 GGCATGGGACGGGCCGGGGAGGG - Intergenic
1152381538 17:79944877-79944899 GGCAGGGGCCAGGGCTGGGGAGG - Intronic
1152396372 17:80035930-80035952 GGCAGGGGCCGGGCCGGGGGCGG - Intergenic
1152477478 17:80527462-80527484 GGCAAGCGCCGGGCTTGGGGTGG + Intergenic
1152569464 17:81115351-81115373 GGTGTGGGCCTGGCCTGGTGGGG + Intronic
1152749899 17:82057813-82057835 GGCATGAGCCGGGGCAGGTGCGG - Intronic
1152811001 17:82382872-82382894 GGGAAGGGCAGGGCCTGGGGTGG - Intergenic
1152923568 17:83077867-83077889 AGGGTGGACCGGGCCTGGGGGGG + Intergenic
1152932966 17:83119915-83119937 GGCCTGGGGAGGGGCTGGGGCGG + Intergenic
1153283375 18:3434949-3434971 GGCATGGACCTGGCCTGAAGTGG + Intronic
1153565578 18:6414660-6414682 GGCGAGGGCCGGGCCGGTGGGGG - Intronic
1153691666 18:7600662-7600684 GGGAAGGGCAGGGCCTGGAGTGG - Intronic
1153900479 18:9614134-9614156 GGCCTGGGCCGGGCCCTGGCTGG - Intronic
1154125608 18:11689658-11689680 GGCCAGGGCCGGGGCCGGGGCGG - Exonic
1155166776 18:23238050-23238072 CCCATGAGCCGGGCCTGGCGGGG + Intronic
1157752959 18:50194789-50194811 GACATGGCCCGGGCCGGGCGGGG + Exonic
1157794259 18:50560059-50560081 GGCTGGGGCCGGGGCCGGGGCGG + Exonic
1158658173 18:59359428-59359450 CGCAGGGGGCGGGTCTGGGGCGG + Exonic
1158920569 18:62187198-62187220 GGGCTGGGGCGGGGCTGGGGCGG + Intergenic
1159511248 18:69400826-69400848 GGGAGGGGGCGGGCCGGGGGGGG - Intergenic
1159947891 18:74457388-74457410 GGCAGGCCCCGCGCCTGGGGCGG + Intronic
1160013814 18:75125847-75125869 GGCTTGCGCCTGGCCTGGAGTGG - Intergenic
1160163212 18:76491271-76491293 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1160164075 18:76495151-76495173 GGGAGGCGGCGGGCCTGGGGAGG + Exonic
1160379394 18:78439985-78440007 TGCATGGGTCTGGCCTGGGAAGG + Intergenic
1160562350 18:79766613-79766635 CGCAGGGTCCGGGCCTGGGAGGG - Intergenic
1160584449 18:79904599-79904621 GGGAGGGGCCGGGCCTGGGAGGG + Intronic
1160630954 18:80246563-80246585 GGAGTGGGCTGGGTCTGGGGCGG + Intronic
1160647575 19:200556-200578 GGCAAGAGCTGGGCCTGGAGAGG + Intergenic
1160647588 19:200588-200610 GGCAAGGGCGGGGCCTGCAGAGG + Intergenic
1160647771 19:201337-201359 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
1160647784 19:201401-201423 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
1160718376 19:586698-586720 GGGAATGGCAGGGCCTGGGGAGG + Intergenic
1160721583 19:599456-599478 GGGAGGGGCTGGGCCTGGGGTGG + Intronic
1160735965 19:662613-662635 GGCAGGGGCTGGGCCTGGCGGGG - Intronic
1160739813 19:680572-680594 GGCGGGGGCGGGGCCTGGGGCGG + Intronic
1160771195 19:831941-831963 GGCAGGGGCGGGGCCGTGGGAGG - Exonic
1160809627 19:1007795-1007817 GGCGGGGGCGGGGCGTGGGGTGG + Intronic
1160831461 19:1106591-1106613 GGCGTGGGCAGGGGCTCGGGCGG - Exonic
1160869246 19:1269503-1269525 GGGAGGGGGCGGGCCCGGGGTGG + Intronic
1160903104 19:1438917-1438939 GGCAGGGGCTGGGCCAGCGGTGG + Intronic
1160906924 19:1455938-1455960 GGTAGGGTCAGGGCCTGGGGCGG + Intronic
1160932819 19:1578651-1578673 GGCCAGGGCTGGTCCTGGGGGGG - Intronic
1161072793 19:2270872-2270894 GGGAGGGCCCGGGCCTGGAGCGG + Intronic
1161112137 19:2476454-2476476 GGGTTGGGCCGGGCCGGGAGCGG + Intronic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161250219 19:3276180-3276202 TGCAGGGGCGGGGCCTGGGGAGG + Intronic
1161364238 19:3868920-3868942 TGCAGGGGCCGGGACTGGCGGGG + Intronic
1161394739 19:4038954-4038976 GGCATGGGTGGGGCCTGCGAGGG - Exonic
1161405886 19:4090892-4090914 GGCGTGTGCCAGGCCTGGGAGGG + Intronic
1161487969 19:4546059-4546081 GGCATGGGGTGGGCCGGGCGCGG - Intronic
1161818693 19:6516153-6516175 GGCGTGGGAAGGGCCTGGAGCGG + Intergenic
1161962238 19:7529278-7529300 GCCATTGGCCGGGGCTGGTGAGG - Intronic
1162026825 19:7899092-7899114 GGCAGGGACCGGGCCGGGGAAGG + Exonic
1162113277 19:8413067-8413089 TGCCTGGGGCGGGGCTGGGGCGG + Intronic
1162123447 19:8486244-8486266 CGCATGGGCCTGGCCATGGGTGG + Exonic
1162136368 19:8557825-8557847 GGACTGGCCTGGGCCTGGGGAGG - Intronic
1162380775 19:10330428-10330450 GCCATGGGGCGGGCCAGGGCAGG - Intronic
1162384309 19:10352360-10352382 GGCATAGGCTGGGCCAGGCGCGG - Intronic
1162474376 19:10891220-10891242 GTCTTGGGCCGGGCATGGGTGGG + Intronic
1162495876 19:11023158-11023180 GGCATGAGCTTGGCGTGGGGTGG + Intronic
1162508967 19:11105600-11105622 GGTATGGGCGGGGCCAGGGTGGG + Exonic
1162578413 19:11513004-11513026 GGCGGGAGCCTGGCCTGGGGTGG + Intronic
1162597323 19:11639582-11639604 GGCATGGGGCGGGCGGGGGAGGG - Intergenic
1162821619 19:13226710-13226732 TGCCTTGGCGGGGCCTGGGGCGG - Intronic
1162872126 19:13594472-13594494 GGCATGTACCGTGCCTGGGTGGG + Intronic
1162905003 19:13818068-13818090 GGCTAGGGGCGGGGCTGGGGCGG - Intronic
1162909907 19:13842982-13843004 GGCAGGGGGCGGGCGCGGGGCGG + Intergenic
1162940354 19:14005803-14005825 GCGAAGGGGCGGGCCTGGGGAGG - Intronic
1163018457 19:14470695-14470717 GACGTGGGGCGGGCCTGGGGAGG + Intronic
1163018720 19:14471788-14471810 GGCAGGGGCAGGGGCAGGGGAGG - Exonic
1163034902 19:14564653-14564675 GCCTTGGGGCGGGGCTGGGGAGG - Intronic
1163035434 19:14566596-14566618 GCCAGGGGCCAGGCCTGGGTGGG + Intronic
1163082639 19:14954617-14954639 GGCATGGGCTGGGCGTGGCCTGG + Intronic
1163304838 19:16471648-16471670 GGCAGGGTCCGGGCCCTGGGCGG + Intronic
1163334309 19:16661080-16661102 CGCGGGGGCCGGGCCTGGGGTGG + Intergenic
1163418711 19:17202407-17202429 GGTATGGGCAGGGCATGGGTGGG - Intronic
1163426283 19:17242702-17242724 GGAAACGGCCTGGCCTGGGGCGG + Intronic
1163573557 19:18097745-18097767 GGCCGGGGCGGGGCCGGGGGCGG + Intronic
1163575715 19:18109904-18109926 GGCAGAGGCCGGGCCGGGGCGGG + Intronic
1163649006 19:18506235-18506257 GACAGGGCCCAGGCCTGGGGCGG - Intronic
1163655742 19:18543730-18543752 GGCTGGGGCGGGGGCTGGGGCGG + Intronic
1163655749 19:18543742-18543764 GGCTGGGGCGGGGGCTGGGGCGG + Intronic
1163655756 19:18543754-18543776 GGCTGGGGCGGGGGCTGGGGCGG + Intronic
1163666675 19:18606849-18606871 GGGCCGGGCCGGGCCGGGGGCGG - Exonic
1163682643 19:18692097-18692119 AGCAAGAGCAGGGCCTGGGGTGG - Intronic
1163700884 19:18785938-18785960 GGCGGGGGCGGGGCCTGCGGTGG - Intronic
1164593028 19:29516578-29516600 GGGATGGGGTGGTCCTGGGGGGG - Intergenic
1164623922 19:29714674-29714696 GGCAGGGGCGGGGCTGGGGGTGG - Intronic
1164976992 19:32581048-32581070 CGGAGGGGCGGGGCCTGGGGCGG - Exonic
1164982142 19:32622106-32622128 CGCAGGGGCAGGGACTGGGGAGG - Intronic
1165080293 19:33302768-33302790 GGCGACGGCCGGGCCGGGGGCGG - Intergenic
1165427875 19:35755740-35755762 GGCGTGGGGCGGGGCTGGAGCGG - Intronic
1165772677 19:38388101-38388123 CGCGTGGGCGGGGCCTCGGGAGG - Intergenic
1165781085 19:38434668-38434690 GGCCTGGGCAGGGGATGGGGAGG + Intronic
1165950807 19:39473114-39473136 TGTACGGGCGGGGCCTGGGGAGG + Exonic
1166072476 19:40395191-40395213 GGCAAGGGCTGGGGCTGGGATGG - Exonic
1166083265 19:40458299-40458321 GGCAGGGGCGGGGCCGGGGGCGG + Intronic
1166084404 19:40465588-40465610 GGCATGAGCCGGGGCGGGCGGGG - Exonic
1166104446 19:40590435-40590457 GGCTTGGGACGGGATTGGGGTGG - Intronic
1166214721 19:41327641-41327663 GGCAGGGGCGGGGCAGGGGGAGG + Intronic
1166745569 19:45140398-45140420 GGCAGGGGCTGGGCCTGGTGGGG + Intronic
1166748942 19:45155654-45155676 GGCTTGGGGAGGGCCTGGGCTGG + Intronic
1166765930 19:45252022-45252044 TGCCAGGGCCGGGCCTTGGGGGG - Intronic
1166873791 19:45885479-45885501 GGCTGGGGCTGGGCCTGCGGGGG + Exonic
1166888027 19:45973347-45973369 TCCATGGGGGGGGCCTGGGGCGG + Exonic
1167008244 19:46788809-46788831 GGAAGGGGCGGGGCCTTGGGAGG + Intergenic
1167088069 19:47324154-47324176 GGCATGGGCCAGGCAGGGCGTGG - Intergenic
1167103806 19:47419236-47419258 GGCAGGCGCCGGGCCGGGTGGGG + Exonic
1167239416 19:48334269-48334291 GGCGTGGGCCGTGCCAGCGGGGG - Intronic
1167644100 19:50696413-50696435 GGGATGGGTCGGGGATGGGGGGG - Intronic
1167647001 19:50711332-50711354 GGGATGTGAGGGGCCTGGGGTGG + Intronic
1167691100 19:50983952-50983974 CGCTGGGGCCGGGCATGGGGCGG - Intronic
1167888676 19:52522670-52522692 GGTGGGGGCCGGGCCTGGGGTGG + Intergenic
1168076200 19:53982024-53982046 GGCGGGGGCGGGGCCGGGGGTGG + Intronic
1168348307 19:55661342-55661364 GCCAGGGGCCGGGCTGGGGGTGG + Intronic
1168669704 19:58231193-58231215 GGCATTGGGCTGGGCTGGGGTGG + Intronic
925022989 2:586840-586862 GGCAGGGGCAGGGCATGGGATGG - Intergenic
925069569 2:956107-956129 GGCATGGGCAGGGGCAGGGCAGG - Intronic
925130209 2:1489053-1489075 GGCATGTGCCGGGCATGTGCGGG - Intronic
925171343 2:1751989-1752011 GCCAAGGGCCTGGGCTGGGGAGG - Intergenic
925635176 2:5935636-5935658 GGCAGGGGCAGGGCCAGGGAAGG - Intergenic
926122897 2:10254482-10254504 GCCCTGAGCCGGGCCTGGCGCGG + Intergenic
926246154 2:11123586-11123608 GGCCAGGGCCAGGCCAGGGGTGG + Intergenic
927039458 2:19213464-19213486 GGCATAGACCCGGCCAGGGGTGG + Intergenic
927179433 2:20434114-20434136 GACAAGGGCCTGGCCTGTGGGGG + Intergenic
927561444 2:24076808-24076830 GGAAGGGGCGGGGCCTGAGGAGG + Intronic
927667507 2:25042520-25042542 GGCACGCGCCGGGCCTGGAGAGG - Intronic
927679269 2:25129341-25129363 GGCGGGGGCGGGGCGTGGGGTGG + Intronic
927956665 2:27211968-27211990 GGCAGGGGGCGGGCAGGGGGCGG - Intronic
928260092 2:29758640-29758662 GGCCTGAGCAGTGCCTGGGGAGG - Intronic
928804259 2:35131872-35131894 GACATGGGAGGGGCCAGGGGTGG - Intergenic
929511380 2:42568502-42568524 CGAGTGGGCCGGGCCGGGGGAGG - Intronic
929584033 2:43102201-43102223 GGCCTCTCCCGGGCCTGGGGAGG - Intergenic
929936418 2:46297340-46297362 GGCTTGGGGCGGGCACGGGGCGG - Intronic
930021210 2:47003286-47003308 GGCATGGGCTGGGTTGGGGGAGG + Intronic
930411050 2:51027447-51027469 GGCCTGGGCGGGGCTCGGGGAGG - Intronic
931602292 2:64017049-64017071 GTGATGGGCCGGGGCCGGGGCGG + Intronic
932063445 2:68529407-68529429 GGCATGGCCAGGACCTGCGGCGG + Intronic
932476474 2:72009366-72009388 GGCAGGGGCAGGGGCGGGGGCGG + Intergenic
932476478 2:72009372-72009394 GGCAGGGGCGGGGGCGGGGGAGG + Intergenic
933893461 2:86790727-86790749 GGGATGGGGCGGGCGGGGGGCGG - Intronic
933973515 2:87489462-87489484 GGCAGGAGCTGGGGCTGGGGTGG + Intergenic
934238597 2:90250481-90250503 GCCATGGCCACGGCCTGGGGAGG - Intergenic
935108683 2:100072082-100072104 GGCATGGGCTGGACATGGGGAGG - Intronic
935622356 2:105141394-105141416 GGGGTGGGCAGGGCCTGGAGAGG - Intergenic
935692580 2:105744763-105744785 GGCCTGGGCCGGCCCCTGGGCGG + Intergenic
935971591 2:108534659-108534681 GGGCCGGGCCGGGCCTGGCGCGG + Intronic
936320210 2:111460751-111460773 GGCAGGAGCTGGGGCTGGGGTGG - Intergenic
936600407 2:113889919-113889941 GGCCTGGGCCTGGCCTGGCCGGG + Intergenic
937271277 2:120654581-120654603 GGCCTGGGCGAGGCCGGGGGCGG + Intergenic
937408089 2:121649213-121649235 GGGATGGGGCGGCCCTGAGGTGG - Intronic
937869372 2:126776725-126776747 GGCTGGGGCGGGGCCTGGGCGGG - Intergenic
938141694 2:128799650-128799672 TGCATGGGCAGAGCCTGGTGAGG + Intergenic
938289167 2:130140438-130140460 GGCCTGGGCGCTGCCTGGGGAGG - Intronic
938292496 2:130157511-130157533 GGCATGAGCCAGGCCAGGAGTGG + Intronic
938310375 2:130285333-130285355 GGCGAGGGCTGGGCTTGGGGAGG + Intergenic
938444559 2:131367036-131367058 GGCAAGGGCTGGGCTTGAGGAGG - Intergenic
938467359 2:131532500-131532522 GGCCTGGGCGCTGCCTGGGGAGG + Intronic
938727468 2:134120715-134120737 GGCGTGGGCCGGGCCGGGCCGGG + Intronic
939928267 2:148201074-148201096 GGCCTGAGCAAGGCCTGGGGAGG - Intronic
942084889 2:172434498-172434520 GGCATGGGGCTGAACTGGGGAGG - Intronic
944630517 2:201619243-201619265 AGCATGGGCCCGGCCTGAGTGGG - Intergenic
945143958 2:206716310-206716332 GGGATGGCTCTGGCCTGGGGTGG - Intronic
946063021 2:216961094-216961116 GCCAGGGGCCAGGGCTGGGGCGG + Intergenic
946253892 2:218429749-218429771 GGCTTGGGGTGGGCCTGGGAGGG + Intronic
946445974 2:219740210-219740232 GGCCTGGGCCATGCCAGGGGCGG + Intergenic
946716493 2:222559167-222559189 AGCAGGGGCCGGGCGGGGGGGGG - Exonic
947528405 2:230893532-230893554 TGCATGGTCAGGGCCTGGGCTGG - Intergenic
947605560 2:231483399-231483421 GGCATGGGGCAGCCATGGGGAGG + Intronic
947749589 2:232525433-232525455 GGCAGGGGCCCGGGCTGGAGAGG + Exonic
947758855 2:232588670-232588692 GACATGGGCTGGGGCTGGTGAGG - Intergenic
947815136 2:233031857-233031879 TGCAGGGCCCTGGCCTGGGGAGG - Intergenic
947826130 2:233107217-233107239 GGCAGGGACCCAGCCTGGGGAGG + Intronic
948139104 2:235659911-235659933 GGCATGGGCCCAGGCTGGTGGGG + Intronic
948153874 2:235765394-235765416 TGGAGGGGCCGGGCCTGTGGGGG - Intronic
948159375 2:235811728-235811750 GAGCTGGGCCGGGCCGGGGGCGG - Intronic
948192493 2:236070759-236070781 GCCCTGGGCCGGGGCAGGGGCGG + Intronic
948202858 2:236142368-236142390 GGCAGGGGCCGGGGCGGGGGCGG - Intergenic
948697165 2:239737923-239737945 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697177 2:239737946-239737968 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697217 2:239738026-239738048 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697263 2:239738122-239738144 GGCTGGGGCCGGGGCTGGGCTGG - Intergenic
948697347 2:239738270-239738292 GGGCTGGGCCGGGGCTGGGCTGG - Intergenic
948700618 2:239757488-239757510 GGCATGGGTCAGGCCTGAGTGGG - Intergenic
948800333 2:240430535-240430557 GCCATGGGCTGGGGGTGGGGGGG - Intergenic
948869855 2:240792389-240792411 GGCCTGGCCAGAGCCTGGGGTGG - Intronic
948882761 2:240868893-240868915 GGCTTGAGCAGGGCCTTGGGGGG - Exonic
1168769799 20:408020-408042 GGCCGGGGCGGGGCCGGGGGCGG - Intronic
1168771735 20:420475-420497 GGCAGGGCCCGGGCCAGGGCTGG - Intronic
1168773186 20:428919-428941 GGCAGGTGCTGGCCCTGGGGCGG - Intronic
1169489112 20:6056324-6056346 GGCAAGGGCCTGGCCTGGCCAGG + Intergenic
1170150080 20:13220135-13220157 GGGCTGGGCCGGCGCTGGGGAGG + Intergenic
1170524763 20:17226847-17226869 GGGCCGGGCCGGGCCGGGGGTGG + Intronic
1171367650 20:24637072-24637094 GCCACGGGCAGGGCCCGGGGAGG + Intronic
1171430564 20:25081289-25081311 GGGAAGGCCCGGGCCTGTGGTGG - Intronic
1171473647 20:25390917-25390939 GGCCGGGGCGGGGCCGGGGGAGG - Exonic
1172161986 20:32875269-32875291 GGAATTGGCCTAGCCTGGGGTGG + Intronic
1172188739 20:33048955-33048977 GGCATGGGCCTGGGCTAGGCTGG - Intergenic
1172383399 20:34515662-34515684 GGGATCGGGCAGGCCTGGGGTGG - Intergenic
1172477935 20:35252835-35252857 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172477949 20:35252873-35252895 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172477963 20:35252911-35252933 GGCAAGGGCCCGGCATGGGCAGG + Intronic
1172477978 20:35252949-35252971 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172477992 20:35252987-35253009 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172478006 20:35253025-35253047 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172478020 20:35253063-35253085 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172478034 20:35253101-35253123 GGCAAGGGCCAGGCATGGGCAGG + Intronic
1172482215 20:35277799-35277821 GGCTGGGGCTGGGGCTGGGGCGG + Intergenic
1172528908 20:35617414-35617436 GGCTTGGGAGGGGCCGGGGGTGG - Intronic
1172731915 20:37095716-37095738 GGCAGGGGTGGGGCCTGGCGAGG + Intronic
1172766621 20:37354587-37354609 GGCAGGGGCAGGGGCCGGGGAGG + Intronic
1173454093 20:43189771-43189793 GGCCGGGGCCGGGACTGGGGCGG + Exonic
1173895730 20:46549481-46549503 TGCCTGGGCCTGGACTGGGGTGG + Intronic
1174246826 20:49188082-49188104 GGGCCGGGCCGGGCCTGGTGGGG - Intronic
1174290329 20:49503824-49503846 GGCATTGGCCGTGCCTGGAATGG - Intergenic
1174513384 20:51072918-51072940 GGCAGGGGCCTGGCCTGGGTGGG + Intergenic
1175218696 20:57404888-57404910 GGCATGGGCCGGCACCAGGGTGG + Intronic
1175530337 20:59670590-59670612 GGCATCTGCCGGGGGTGGGGGGG + Intronic
1175740995 20:61419680-61419702 AGCATGGGCCATGCCTGGAGCGG - Intronic
1175795409 20:61767521-61767543 GGCAGGAGCAGGGCCTTGGGCGG + Intronic
1175887975 20:62303054-62303076 GGGAGTCGCCGGGCCTGGGGCGG + Intronic
1175897697 20:62346638-62346660 GGAATGGGCTGGCCCTGAGGTGG - Intronic
1175947472 20:62565564-62565586 AGCATGGCCCGTGGCTGGGGAGG + Intronic
1175963337 20:62648052-62648074 GGCTGGGGGCAGGCCTGGGGAGG - Intronic
1175964631 20:62654398-62654420 GGCCTGCGCTGGGGCTGGGGTGG - Intronic
1176002676 20:62840041-62840063 GGCATGGTGCGGGCATGGTGCGG - Intronic
1176005578 20:62860954-62860976 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1176020235 20:62958982-62959004 GACCTGGGCAGTGCCTGGGGAGG - Intronic
1176031706 20:63016041-63016063 GGCCTGGGCGGGGCGGGGGGAGG - Intergenic
1176098888 20:63356162-63356184 GGCAGGGGCAGGGCCAGGGCAGG + Intronic
1176141751 20:63547893-63547915 GGCATGGGCCAGGCCTGACTGGG - Intronic
1176146527 20:63567961-63567983 GGGAAGGCCCCGGCCTGGGGAGG + Intronic
1176159696 20:63641926-63641948 GGCAGGGGCCGGGGCGGGGCCGG - Intronic
1176159749 20:63642051-63642073 GGCAGGGGCCGGGGCGGGGCCGG - Intronic
1176194610 20:63831398-63831420 GGCGTGGGCGGGGCCCGGGGCGG - Intergenic
1176377239 21:6092712-6092734 GAGAGGGGCCGGGCCTGTGGCGG - Intergenic
1176384730 21:6133682-6133704 GGCCTGGGGCGAGCCTGGTGGGG + Intergenic
1178342311 21:31796343-31796365 GGCAGGGGCTGGGCATGGGGTGG + Intergenic
1179596309 21:42445255-42445277 GGGAAGGGCTGGGACTGGGGTGG - Intronic
1179738742 21:43404570-43404592 GGCCTGGGGCGAGCCTGGTGGGG - Intergenic
1179746236 21:43445532-43445554 GAGAGGGGCCGGGCCTGTGGCGG + Intergenic
1179810380 21:43865691-43865713 GGCCCGGGCCGGGCCGAGGGAGG + Intronic
1179889101 21:44326882-44326904 GGCATGGGTGGGGGCTGGGGAGG - Exonic
1179911906 21:44455286-44455308 GGCATGGGAGGGGCATGGGAGGG - Intergenic
1180042325 21:45287183-45287205 GGCAGGGGCCGGGGCCGGGCTGG - Intronic
1180064278 21:45405027-45405049 GGCAGGGGCCGGGCAGGGGGCGG - Intergenic
1180064293 21:45405055-45405077 GGCAGGGGGCGGGCGCGGGGCGG - Intergenic
1180064310 21:45405088-45405110 GGCAGGGGCCGGGCAGGGGGCGG - Intergenic
1180064317 21:45405099-45405121 GGCAGGGGCCGGGCAGGGGCCGG - Intergenic
1180109948 21:45643102-45643124 GGCTTGGGGCGGGCCTGTGGTGG - Intergenic
1180140641 21:45891817-45891839 AGAAGGGGCCGGGCCAGGGGAGG - Intronic
1180144727 21:45912817-45912839 GACTTGAGCTGGGCCTGGGGTGG - Intronic
1180285436 22:10741497-10741519 GGCATGGGCCGGGCCTGGGGTGG - Intergenic
1180701170 22:17782141-17782163 GGGCTGGGCCAGCCCTGGGGCGG - Intergenic
1180762330 22:18219973-18219995 GGCATGGGCCGGGTCGAGGTGGG + Intergenic
1180773338 22:18404635-18404657 GGCATGGGCCGGGTCGAGGTGGG - Intergenic
1180804691 22:18654184-18654206 GGCATGGGCCGGGTCGAGGTGGG - Intergenic
1180806057 22:18715226-18715248 GGCATGGGCCGGGTCGAGGTGGG + Intergenic
1180819188 22:18813879-18813901 GGCATTGGCTGGGCGTGGGGTGG - Intergenic
1180891474 22:19291849-19291871 GGCAGGGGCGGGGGCAGGGGCGG - Intergenic
1180891481 22:19291861-19291883 GGCAGGGGCGGGGGCAGGGGCGG - Intergenic
1180980579 22:19876345-19876367 GGCAGGGGCCGGGGCAGGGTGGG - Intronic
1181031481 22:20150429-20150451 GGCTGGGGCTGGGGCTGGGGCGG + Intronic
1181045205 22:20211050-20211072 GGCCTGGGCGGGGGCTGGGGTGG + Intergenic
1181192434 22:21151568-21151590 GGCATGGGCCGGGTCGAGGTGGG - Intergenic
1181205413 22:21248327-21248349 GGCATTGGCTGGGCGTGGGGTGG - Intergenic
1181256747 22:21567788-21567810 GGCAGCGGCCGGGCGTGGGGCGG + Intronic
1181520774 22:23448339-23448361 AGCATGGGCCTCGCCTGGGTGGG + Intergenic
1181748607 22:24973322-24973344 GGAATGGGCGGGTCATGGGGAGG - Intronic
1181967408 22:26666785-26666807 GGCAAGGCCTGGGCCTGGGGAGG + Intergenic
1182356733 22:29725579-29725601 GGCAAGAGCAGGGCCTGTGGGGG + Intronic
1182358779 22:29734826-29734848 GGCTGGGGCTGGGGCTGGGGCGG - Intronic
1182550192 22:31096770-31096792 GGCACGGGGCCGGCCAGGGGAGG + Exonic
1182697685 22:32207512-32207534 CGGCTGGGCCTGGCCTGGGGTGG + Intergenic
1182712587 22:32332035-32332057 GGATTGGCCAGGGCCTGGGGTGG - Intergenic
1183456555 22:37926087-37926109 GGTGGGGCCCGGGCCTGGGGAGG + Intronic
1183464633 22:37973455-37973477 GGCAGGGGCTGGGCGGGGGGTGG + Exonic
1183630182 22:39027843-39027865 GGCATGGGCTGGGGCAGGTGGGG - Intronic
1183642518 22:39101148-39101170 GGCGGGGGCCGGGACGGGGGCGG - Intronic
1183650834 22:39152470-39152492 GGGCCGGGCCGGGCCGGGGGCGG + Exonic
1183716288 22:39535362-39535384 CGTGTGGGCCGGGCCTGGGTGGG + Intergenic
1183731962 22:39623102-39623124 GGCATGGGACGGGACACGGGCGG + Intronic
1183945729 22:41324749-41324771 GGCAGGGGAGGGGCCTGAGGTGG + Intronic
1183956004 22:41381348-41381370 GGCGGGGGCGGGGCCCGGGGCGG - Intronic
1184294370 22:43514677-43514699 GGCAAGGGGCGGGCCTGGAAGGG + Intergenic
1184386811 22:44181400-44181422 GGAAGGGGCCTGGCCCGGGGCGG + Intronic
1184439193 22:44498233-44498255 GGCCGGGGCCGGGGCAGGGGCGG + Exonic
1184642254 22:45878932-45878954 GGAATGGGCCGGGGCAGGGAGGG + Intergenic
1184648657 22:45909599-45909621 GGGAGGGACCAGGCCTGGGGTGG + Intergenic
1184674728 22:46035689-46035711 GGCTGGGGCGGGGCCTGGGCGGG - Intergenic
1184674761 22:46035782-46035804 GGCTTGGGCGGGGCCTGGGCGGG - Intergenic
1184676449 22:46045684-46045706 GCCATGGACAGGGCCTGGGGAGG + Intergenic
1184688353 22:46106475-46106497 GGCAGGGGCCAGGCCTGCTGTGG - Intronic
1184715942 22:46281901-46281923 GGCAAGGTATGGGCCTGGGGTGG - Intronic
1184745371 22:46452814-46452836 GGCATGTGCTGGGCCAAGGGCGG - Intronic
1184759755 22:46537650-46537672 GGGCGGGGCCGGGCCGGGGGCGG - Intergenic
1184786014 22:46672358-46672380 GGGATGGGCTGGGCGTGGGGGGG + Intronic
1185051354 22:48555882-48555904 GGGCTGGGCCTGGCCTTGGGTGG + Intronic
1185285825 22:49999611-49999633 GGCCTAGGCCTGGCCGGGGGCGG + Intronic
1185285864 22:49999691-49999713 GGCCTAGGCCTGGCCGGGGGCGG + Intronic
1185288113 22:50011279-50011301 GGCAAGGGCAGGGGCTGAGGCGG - Intronic
1185389392 22:50550556-50550578 GGAGTGGGCCTGGCCTGGTGTGG - Exonic
1185419706 22:50728606-50728628 GGCAGGGGCAGGGCCAGGGTAGG + Intergenic
1203221512 22_KI270731v1_random:47089-47111 GGCATTGGCTGGGCGTGGGGTGG + Intergenic
1203235168 22_KI270731v1_random:145617-145639 GGCATGGGCCGGGTCGAGGTGGG - Intergenic
1203269314 22_KI270734v1_random:39732-39754 GGCATTGGCTGGGCGTGGGGTGG - Intergenic
949559259 3:5187572-5187594 GGCCTGGGCCCGGCCTCGCGGGG - Intergenic
950008340 3:9705217-9705239 GGAAGGGGTCGGGCCTGAGGTGG - Intronic
950400958 3:12768909-12768931 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
950730093 3:14948587-14948609 GGCGGGGGCGGGGCCGGGGGCGG + Intronic
950940381 3:16885086-16885108 GCCGAGGGCCGGGCCCGGGGAGG - Intronic
950948321 3:16974133-16974155 GGCATGAGCCAGGACTTGGGAGG + Intronic
952927208 3:38328884-38328906 GGCCTTGGGCGGGCCTTGGGCGG + Intergenic
953181690 3:40600924-40600946 GACATGGGTTGGCCCTGGGGTGG + Intergenic
953246797 3:41200041-41200063 GGGATGCGCCGGGCCCTGGGTGG + Intronic
953909182 3:46883197-46883219 GGCGGGGGGCGGGCCGGGGGCGG + Intronic
954004163 3:47578674-47578696 GCCATGGGGCGAGCCGGGGGCGG - Exonic
954332497 3:49898462-49898484 GGGACAGGCTGGGCCTGGGGTGG - Intronic
954361316 3:50124288-50124310 GGCCTGGGCCGGGGCCAGGGCGG - Intergenic
954378053 3:50205208-50205230 GGCGGGGGGCGGGCCGGGGGCGG + Intergenic
954438004 3:50506087-50506109 GGCTTGGGACGGGCCTCGAGTGG - Intergenic
954457510 3:50607824-50607846 GGCATAGGCAGGGCCGGGGTGGG + Exonic
954697827 3:52436923-52436945 GGCATTGGCCGGGGCAGGGAAGG - Intronic
954793013 3:53146686-53146708 GGCATGGGCAGTGCAAGGGGGGG + Intergenic
954795860 3:53161140-53161162 GGCGGGGGCGGGGCCTGGCGGGG + Exonic
955228435 3:57079304-57079326 GGGCTGGGCGGGGCCGGGGGCGG + Exonic
956678127 3:71754003-71754025 GGCAGGGGACGGCCCCGGGGCGG + Intronic
961326926 3:126114535-126114557 GGTGAGGGCCGGGCCTGGAGGGG - Exonic
961372730 3:126441230-126441252 GGCCTGGGCCTGCCCTGGAGGGG + Intronic
961456844 3:127028647-127028669 GGGATGGGACGGGTTTGGGGTGG + Intronic
961469131 3:127100584-127100606 GGGATGGGGCGGGCCTGCGGAGG - Intergenic
961666837 3:128497938-128497960 GGCCGGGGCCGGGGCAGGGGAGG - Intergenic
961929383 3:130517116-130517138 GGGAAGGGTCGGGCCCGGGGCGG + Intergenic
962129685 3:132659837-132659859 AGCATGGGCCGAGGCCGGGGTGG + Exonic
963213920 3:142724195-142724217 CGCAGGGGCCGCGCCTGGGGCGG - Exonic
964010724 3:151888071-151888093 GGGCTGAGCTGGGCCTGGGGTGG + Intergenic
964011533 3:151898300-151898322 GGGCTGAGCTGGGCCTGGGGTGG - Intergenic
967207813 3:187139540-187139562 GGCCTGGGCGGGGCCGGGGCGGG - Intronic
967941199 3:194768009-194768031 GTCTTGGGCAGGGCCTGGGGTGG + Intergenic
968002992 3:195220432-195220454 AGCATGGGCCCGGCCGGGCGAGG - Intronic
968370063 3:198218714-198218736 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
968370076 3:198218778-198218800 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
968521830 4:1037679-1037701 GGGGCGGGCGGGGCCTGGGGAGG - Intergenic
968562988 4:1294812-1294834 GGCAGGGGCAGGGGCAGGGGCGG + Intronic
968562992 4:1294818-1294840 GGCAGGGGCAGGGGCGGGGGTGG + Intronic
968593670 4:1471907-1471929 GACATGGGTCCGGCCTGGGCAGG - Intergenic
968640824 4:1713556-1713578 GGGATGCCCAGGGCCTGGGGAGG - Intergenic
968650623 4:1758960-1758982 GGCACAGGGCTGGCCTGGGGTGG - Intergenic
968652928 4:1767221-1767243 CGCTGGGGCCGGGCCAGGGGCGG + Intergenic
968663369 4:1807986-1808008 GCCCTGGGCGGGGCGTGGGGGGG + Exonic
968701065 4:2058663-2058685 GGCGGGGGCCGGGCCGGGAGGGG + Intergenic
968724941 4:2242357-2242379 GACAGGGGCGGGGCCTGGGCAGG + Intergenic
968735000 4:2290697-2290719 GGCAGGGGCCAGGCCAGGGCTGG + Intronic
968905714 4:3449711-3449733 GGCCTGGGGCTGGCCTGGGAGGG - Intergenic
968975557 4:3820531-3820553 GGCCCGGGCTGGGGCTGGGGTGG + Intergenic
969095318 4:4728541-4728563 GGCATGGGTAGGGGCTGGGGTGG + Intergenic
969153193 4:5187605-5187627 GGCAGGGGCCGGGCGGGGGAGGG + Intronic
969244913 4:5925696-5925718 GACATGGCCCTGGCCTTGGGGGG + Intronic
969285415 4:6199676-6199698 GGCGTGTGCCGTGCGTGGGGTGG + Intronic
969442021 4:7222826-7222848 GTCATGGGGCTGGCCTGGGGAGG + Intronic
969461013 4:7328995-7329017 CGCATGGGCCTGGCCTCGGGGGG - Intronic
969484735 4:7465960-7465982 GGCAGGGGCAGGGCCAGGGTGGG + Intronic
969625954 4:8305899-8305921 GCTCTGGGCCGGGCCTGGGAAGG + Intronic
969639708 4:8389437-8389459 GGCATGGGCAAAGGCTGGGGTGG - Intronic
969721279 4:8894169-8894191 AGCACGGGCTGGGCCGGGGGCGG - Intergenic
971877766 4:32326845-32326867 GGCAAGGCCAGGGCCTGGGGTGG - Intergenic
972331765 4:38070425-38070447 GGCATGACCCGGCCATGGGGAGG + Intronic
972770988 4:42196872-42196894 GGCAGGGGCGGGGGCGGGGGCGG - Intergenic
979258761 4:118630679-118630701 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
979258774 4:118630743-118630765 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
979329575 4:119409813-119409835 GGCAGAGGCTGGGCCTGGAGGGG + Intergenic
979329588 4:119409877-119409899 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
979565780 4:122152590-122152612 GGGATGGGCCGGGCCAGACGGGG + Intronic
980085642 4:128387428-128387450 GGGATGGGCCGGTCCTGGGAAGG + Intergenic
981128462 4:141132864-141132886 GGGGTTGGCCGGGGCTGGGGAGG - Intronic
981737068 4:147964079-147964101 GGAATGGGCCAGCCCTGGGAGGG - Intronic
981782139 4:148442426-148442448 GGCAGGGGCAGGGCCAGGGCGGG + Exonic
985552757 5:541695-541717 GGCCTGGAGAGGGCCTGGGGCGG + Intergenic
985574077 5:665639-665661 GGCCTGGGGGGGTCCTGGGGAGG - Intronic
985577135 5:678682-678704 GGCCTGGCCCCGGCCAGGGGAGG + Intronic
985595212 5:784829-784851 CGCATGCTCCGGGCCTGGTGGGG - Intergenic
985853145 5:2403499-2403521 GGCATAGGCTGGGGCTGAGGAGG + Intergenic
986409659 5:7464608-7464630 GGCATGGACCAGAGCTGGGGTGG + Intronic
986443627 5:7802068-7802090 GGATTGGGCCGCGGCTGGGGTGG + Intronic
986608661 5:9546269-9546291 GGAAGGGGCGGGGCCCGGGGAGG - Intergenic
986738997 5:10689374-10689396 GGAATGAGCTGGGCCTGTGGGGG - Intronic
987050837 5:14145016-14145038 GGCCAGGTCCGGGCCTGGAGAGG + Intronic
989176304 5:38530130-38530152 GGCAGGGGATGGGCCTGGGAGGG + Intronic
989478782 5:41904281-41904303 GGCACGGGCGGGGCCTAGGGCGG - Intronic
990003665 5:50922336-50922358 GGGATGGGCAGGGCCTGGGCAGG - Intergenic
992563151 5:77972584-77972606 GGCCCGGGCCGGGCCAGGGGTGG + Intergenic
992939573 5:81750249-81750271 GGCTGGGGCTGGGGCTGGGGCGG - Intronic
994583920 5:101682153-101682175 GGCATGGCTAGGGACTGGGGAGG - Intergenic
994999703 5:107111666-107111688 GGCAGGGGCCGGGGGTGGGGGGG + Intergenic
995038699 5:107564086-107564108 GGGATGGGCAGGGGCTGGGCAGG + Intronic
995120366 5:108530143-108530165 GGCATGGGCAGGGGCAGGGTAGG + Intergenic
996376349 5:122812192-122812214 GGCATGGGGCCAGCGTGGGGAGG - Intronic
996755667 5:126932517-126932539 GGCATGATCCTGGGCTGGGGAGG + Intronic
997129607 5:131263905-131263927 GGCGGGGGCGGGGCCTGGCGGGG + Intronic
997470479 5:134114636-134114658 GGGGCGGGCCGGGCCGGGGGCGG - Intergenic
997528237 5:134567067-134567089 GGCACGTGCCGGGCCAGGGCAGG + Intronic
997976706 5:138445381-138445403 GGCAGGGCCCGGGGTTGGGGTGG + Intronic
997980599 5:138465544-138465566 GGCAGGGGCCGGTCCTGCGGCGG - Exonic
998018847 5:138753381-138753403 GGCGGGGGGCGGGCCGGGGGCGG + Intronic
998307762 5:141096270-141096292 GGCAGGTGCGGGTCCTGGGGCGG - Exonic
998308399 5:141102123-141102145 GGCAGGTGCGGGTCCTGGGGCGG - Exonic
998310309 5:141123469-141123491 GGCAGGTGCGGGTCCTGGGGCGG - Exonic
998312749 5:141151725-141151747 GGCAGGTGCGGGTCCTGGGGCGG - Exonic
998317912 5:141201248-141201270 GGCAGGTGCAGGTCCTGGGGCGG - Exonic
998319435 5:141215597-141215619 GGCAGGTGCGGGTCCTGGGGCGG - Exonic
998320413 5:141224979-141225001 GGCAGGTGCCGGTCCTGGGGCGG - Exonic
998321423 5:141236028-141236050 GGCAGGTGCGGGTCCTGGGGCGG - Intergenic
1001825604 5:174742794-174742816 GGGTTGGGGCGGGCCGGGGGGGG - Intergenic
1002076776 5:176713023-176713045 GGCCTGGGACAGGTCTGGGGTGG + Intergenic
1002104499 5:176873469-176873491 GGCCTGGGGCAGGTCTGGGGAGG - Intronic
1002168583 5:177362798-177362820 GGGAGGGGTGGGGCCTGGGGAGG + Intronic
1002175349 5:177398310-177398332 GGAATGGGGAAGGCCTGGGGTGG + Exonic
1002296195 5:178232622-178232644 GGCAGGGGCGGGGCCCGGAGCGG - Exonic
1002446705 5:179294610-179294632 GGCGGGGGCAGGGCTTGGGGTGG - Intronic
1002729342 5:181324292-181324314 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
1002729355 5:181324356-181324378 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
1002729799 5:181326317-181326339 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1003218433 6:4135781-4135803 GGCATGGGCGGGGCCAGGGTTGG + Intergenic
1004532428 6:16465595-16465617 GGCAAGGGCAGGGTCTGGGGTGG + Intronic
1006037919 6:31228653-31228675 AGCATGGGCCGTGCCTGTTGTGG - Intergenic
1006170217 6:32087925-32087947 GGCCGGGGCCGGGACTTGGGGGG + Intronic
1006188348 6:32192672-32192694 GGGATGGGCGGGGCCCGTGGGGG - Exonic
1006300734 6:33192508-33192530 GGCGGGGGCCGGGCCGGGGGCGG - Intergenic
1006396043 6:33788510-33788532 GGCGAGGGCCCGGCCTGAGGTGG - Exonic
1006429373 6:33985660-33985682 TGAATGGGCGGGGCCGGGGGAGG - Intergenic
1006460479 6:34154955-34154977 CCCAGCGGCCGGGCCTGGGGCGG + Intronic
1006535678 6:34696890-34696912 GGAAGGGGCGGGGCCTGGGCGGG - Intergenic
1006751848 6:36383205-36383227 GCCATGGACCGGGGATGGGGAGG + Intronic
1007209945 6:40185312-40185334 GGCAGGGGCCGGGGTTGGGGGGG + Intergenic
1007255283 6:40523995-40524017 GGCAGGGGGAGGGGCTGGGGAGG + Intronic
1007665419 6:43510399-43510421 GGCCTTGGCCGGGCAGGGGGCGG - Exonic
1007729882 6:43939423-43939445 GGCAGGGGGTGGGCCTGAGGGGG - Intergenic
1007775649 6:44223172-44223194 GGCGTGGGCAGGGCTTGGGAAGG + Intronic
1007784299 6:44271060-44271082 GGAAGGGGCCGCGCCGGGGGCGG + Intronic
1007937069 6:45741896-45741918 GGCGCGGGGCGGGGCTGGGGTGG - Intergenic
1009398741 6:63230279-63230301 GGCATGGCCAGGACCTGCGGTGG + Intergenic
1010083052 6:71886597-71886619 GGCTGGGGCTGGGACTGGGGCGG - Intergenic
1010209891 6:73354340-73354362 GTCCTGGCCCGGGCCGGGGGCGG - Intergenic
1012454997 6:99393993-99394015 CGCATGCGCCGGGGGTGGGGCGG - Intronic
1014477241 6:121888744-121888766 GGCATGGGGCGGGCGTGGGGGGG - Intergenic
1016328175 6:142926815-142926837 GGTCTGGGCCGGCCCTGCGGCGG + Intronic
1016827760 6:148404543-148404565 GGGATGGGCTGGGCTGGGGGTGG - Intronic
1016936329 6:149451363-149451385 GACAGGGGCCCGGCCTGGCGCGG - Exonic
1017671835 6:156777203-156777225 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1018170538 6:161140082-161140104 GGCATGTGCCGGGCCGGGCTGGG - Intronic
1018818883 6:167357707-167357729 GGAATGAGCCGTGCCTGGGGTGG + Intronic
1018826945 6:167415578-167415600 GCCCTGGACCGGGCCTGGGAAGG - Intergenic
1019111958 6:169724065-169724087 GGCAGGGGCCGGCCCCCGGGCGG - Intronic
1019125922 6:169840091-169840113 GGCATGGGCGGGGTGTGGTGTGG - Intergenic
1019126037 6:169840548-169840570 GGCATGGGCGCGGCATGGAGTGG - Intergenic
1019172015 6:170138047-170138069 GGCCAGGGCCGGGCCGGGCGAGG - Intergenic
1019179032 6:170175805-170175827 GGCAGGGGCGGGGGCGGGGGCGG - Intergenic
1019289962 7:245532-245554 GGCAGGGGCCGGCCTTGGTGGGG + Intronic
1019473391 7:1232955-1232977 GGCGCGGGCCGGGGCCGGGGCGG - Exonic
1019502010 7:1369284-1369306 GGGATGGGCGGGGCCTAGGATGG - Intergenic
1019590468 7:1827908-1827930 AGCATGGGCCTCGCCTGGGTGGG - Intronic
1019629929 7:2043626-2043648 GGCACGCGGAGGGCCTGGGGGGG + Intronic
1019723910 7:2590169-2590191 GACACTGGCGGGGCCTGGGGAGG - Intronic
1019723925 7:2590225-2590247 GACACTGGCGGGGCCTGGGGAGG - Intronic
1019732738 7:2636819-2636841 GGCAGCGGCCGGGCCAAGGGTGG - Intronic
1020016531 7:4834929-4834951 GGCAGGGGCTGGGCCTGCGCGGG + Exonic
1020087707 7:5320502-5320524 GGGAGGGGCGGGGCCTCGGGAGG - Intronic
1020090014 7:5333561-5333583 GCAATGGGTGGGGCCTGGGGTGG - Intronic
1020274384 7:6615714-6615736 GGCCTGGGCCGGGCCGCGCGGGG - Exonic
1022112390 7:27239645-27239667 GGCCTGGCCCGGGCCGGAGGGGG - Intergenic
1022495386 7:30850046-30850068 GGCATGGCCAGGGCCAGGGCAGG + Intronic
1023221239 7:37921363-37921385 AGCATGGTCCGGGACTGGGAGGG + Intronic
1023400774 7:39792140-39792162 GGCTGGAGCTGGGCCTGGGGAGG - Intergenic
1023582740 7:41699955-41699977 GGCATTGGCAGGGGGTGGGGAGG - Intronic
1023839428 7:44088086-44088108 GGCAGGGCCCTGGCCTGGGTGGG + Intergenic
1023850285 7:44146304-44146326 GGCGTGGGCGGGGCCCGGGGCGG - Intronic
1023880734 7:44319599-44319621 TGCAGGGGCTGGGCCTGTGGAGG - Intronic
1023935834 7:44739164-44739186 GGCATGGGTGGGGCCTGAGGTGG + Intergenic
1023938978 7:44758055-44758077 GGCAGTGGCTGGGCCTGGGGAGG - Exonic
1024046529 7:45589322-45589344 GGCCCGGGCCGGGCCGGGGTTGG + Intronic
1024073670 7:45807729-45807751 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
1024073683 7:45807793-45807815 GGCAGAGGCTGGGCCTGGAGAGG - Intergenic
1024073773 7:45808244-45808266 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1024074240 7:45810655-45810677 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1024649093 7:51389543-51389565 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1024649654 7:51392407-51392429 GGCAGAGGCTGGGCCTGGAGAGG + Intergenic
1024649668 7:51392471-51392493 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
1024984632 7:55184196-55184218 GCCATGTGCTGGGCCTGTGGTGG - Intronic
1025053173 7:55744873-55744895 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025053642 7:55747286-55747308 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1025053731 7:55747737-55747759 GGCAGAGGCTGGGCCTGGAGAGG + Intergenic
1025053744 7:55747801-55747823 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
1025131745 7:56377760-56377782 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1025131836 7:56378211-56378233 GGCAGAGGCTGGGCCTGGAGAGG + Intergenic
1025131849 7:56378275-56378297 AGCATGAGCTGGGCCTGGTGAGG + Intergenic
1025175851 7:56802105-56802127 GGCAAGAGCTGGGCCCGGGGTGG + Intergenic
1025175922 7:56802423-56802445 GGCAGGGGCTGGCCCTGGAGAGG + Intergenic
1025176076 7:56803133-56803155 GGCAGGAGCCGAGCCTGGAGAGG + Intergenic
1025176470 7:56804738-56804760 GGCAGGGGCTGGACCTGGAGAGG - Intergenic
1025177795 7:56810738-56810760 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025177866 7:56811043-56811065 GGCAGGAGCTGGGCCTGCGGAGG + Intergenic
1025177950 7:56811373-56811395 GGCCAGAGCTGGGCCTGGGGAGG + Intergenic
1025178027 7:56811686-56811708 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025178065 7:56811815-56811837 GGCAGGGGCTGGGCCTGGAAAGG + Intergenic
1025178383 7:56813127-56813149 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025178445 7:56813377-56813399 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025178813 7:56814869-56814891 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025178875 7:56815119-56815141 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025179012 7:56815707-56815729 GGCAAGAGCCGGGCCTGCAGAGG + Intergenic
1025179251 7:56816659-56816681 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025179311 7:56816909-56816931 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025179709 7:56818545-56818567 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025179769 7:56818795-56818817 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025180157 7:56820383-56820405 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025180218 7:56820633-56820655 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025180628 7:56822365-56822387 GGCCGGAGCTGGGCCTGGGGAGG + Intergenic
1025180689 7:56822615-56822637 GGCAGGAGCTGGGCCTGCGGGGG + Intergenic
1025181073 7:56824212-56824234 GGCCGGAGCTGGGCCTGGGGAGG + Intronic
1025181132 7:56824462-56824484 GGCAGGAGCTGGGCCTGCGGGGG + Intronic
1025181502 7:56825954-56825976 GGCCGGAGCTGGGCCTGGGGAGG + Intronic
1025181564 7:56826204-56826226 GGCAGGAGCTGGGCCTGCGGGGG + Intronic
1025181944 7:56827796-56827818 GGCCAGAGCTGGGCCTGGGGAGG + Intergenic
1025182541 7:56830839-56830861 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1025182633 7:56831290-56831312 GGCAGAGGCTGGGCCTGGAGAGG + Intergenic
1025182784 7:56832086-56832108 GGCAGGAGCTGGGCCTGGAGAGG + Intergenic
1025182918 7:56832729-56832751 GGCAGGAGCTGGGCCTGGTGAGG + Intergenic
1025206607 7:56996664-56996686 GGGAGGGGCGGGGCCTCGGGAGG + Intergenic
1025261175 7:57418086-57418108 TGCATGGAGCCGGCCTGGGGTGG - Intergenic
1025665333 7:63580263-63580285 GGGAGGGGCGGGGCCTCGGGAGG - Intergenic
1025689008 7:63744245-63744267 GGCAGGAGCTGGGCCTGGTGAGG - Intergenic
1025689142 7:63744888-63744910 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1025689293 7:63745684-63745706 GGCAGAGGCTGGGCCTGGAGAGG - Intergenic
1025689389 7:63746155-63746177 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1025689976 7:63749199-63749221 GGCCAGAGCTGGGCCTGGGGAGG - Intergenic
1025690354 7:63750776-63750798 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025690411 7:63751026-63751048 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025690803 7:63752599-63752621 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025691243 7:63754374-63754396 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025691299 7:63754624-63754646 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025691738 7:63756448-63756470 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025692128 7:63758021-63758043 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025692185 7:63758271-63758293 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025692576 7:63759844-63759866 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025692632 7:63760094-63760116 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025692990 7:63761523-63761545 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025693047 7:63761773-63761795 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025693436 7:63763346-63763368 GGCAGGAGCTGGGCCTGCGGGGG - Intergenic
1025693493 7:63763596-63763618 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025693956 7:63765498-63765520 GGCCGGAGCTGGGCCTGGGGAGG - Intergenic
1025695320 7:63771648-63771670 GGCAGGGGCTGGACCTGGAGAGG + Intergenic
1025695718 7:63773289-63773311 GGCAGGAGCCGAGCCTGGAGAGG - Intergenic
1025695871 7:63773999-63774021 GGCAGGGGCTGGCCCTGGAGAGG - Intergenic
1025695942 7:63774317-63774339 GGCAAGAGCTGGGCCCGGGGTGG - Intergenic
1025738490 7:64175296-64175318 TGCATGGAGCCGGCCTGGGGTGG - Intronic
1025776782 7:64567964-64567986 GGGATGGGGTGGGACTGGGGAGG - Intergenic
1025912356 7:65839072-65839094 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1025912536 7:65839995-65840017 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1025912803 7:65841291-65841313 GGCATGAGCTGGGCCTGGACAGG - Intergenic
1025912821 7:65841386-65841408 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1025976861 7:66377037-66377059 GGCAGGAGCCTGGCCTGGGGAGG + Intronic
1025976980 7:66377426-66377448 GGCAGGAGCCGGGCCTGGAGCGG + Intronic
1025977093 7:66378058-66378080 GGCAAGGGCTGGGCCTCGGGAGG + Intronic
1026045209 7:66902214-66902236 GGCAGGAGCTGGGCCTGGCGAGG - Intergenic
1026045241 7:66902351-66902373 GGCAAGAGCTGGGCCTGTGGAGG - Intergenic
1026045422 7:66903091-66903113 GGCAAGAGCTGGGCCTGGGAAGG - Intergenic
1026045583 7:66903741-66903763 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1026045730 7:66904296-66904318 GGCACGAGCTGGGCCTGGAGGGG - Intergenic
1026045741 7:66904328-66904350 GGCGGGAGCCGGGCCTGGAGAGG - Intergenic
1026045786 7:66904468-66904490 GGCAGGAGCTGGGCCTGGCGAGG - Intergenic
1026045819 7:66904564-66904586 GGCAGGAGCTGGGCCTGAGGCGG - Intergenic
1026045943 7:66905331-66905353 GACAGGAGCCGGGCCTGGTGAGG - Intergenic
1026046114 7:66906211-66906233 GGCAGGAGCTGGGCCTGGAGAGG - Intergenic
1026732664 7:72925188-72925210 GGCCGGGGCCGGGGCTGCGGCGG + Intronic
1026833477 7:73623749-73623771 GGCTTGGGCCGGGGCTGCTGGGG + Intronic
1026990295 7:74581307-74581329 GCAATGGGCCGGGCATGCGGTGG - Intronic
1027111401 7:75442631-75442653 GGCCGGGGCCGGGGCTGCGGCGG - Intronic
1027190881 7:75994781-75994803 GGCCTGGACCGGGACTGGGACGG + Intergenic
1027202280 7:76071775-76071797 GGCAAGAGCTGGGCCTGGTGGGG + Intergenic
1027202299 7:76071849-76071871 GGCAGGAGCTGGGCCTGGCGAGG + Intergenic
1027202451 7:76072432-76072454 TGCAGGAGCCGGGCCTGCGGAGG + Intergenic
1027202493 7:76072597-76072619 GGCACGAGCCGGGCCCGGAGAGG + Intergenic
1027202584 7:76072954-76072976 GGCAAGAGCTGGGCCTGGCGGGG + Intergenic
1027202601 7:76073028-76073050 GGCAGGAGCTGGGCCTGGCGAGG + Intergenic
1027202672 7:76073293-76073315 GGCAAGAGCTGGGCCCGGGGAGG + Intergenic
1027230303 7:76268251-76268273 TGGATGGGCTGGGCCTGGGTTGG + Intronic
1027745447 7:82068241-82068263 GGCAGGGGGCGGGGCTGGAGGGG - Intronic
1028147483 7:87334380-87334402 TCCATGGGTCGGGGCTGGGGAGG + Intergenic
1029121214 7:98269651-98269673 GGCATGAGCCCAGCCTGAGGTGG + Intronic
1029211274 7:98910198-98910220 GGCAGGGACAGGGGCTGGGGAGG - Exonic
1029371859 7:100155379-100155401 GAGAGGGGCCGGGCCTCGGGTGG + Exonic
1029444322 7:100604246-100604268 GGCCGGGGCGGGGCCTGGAGGGG - Intronic
1029459802 7:100688056-100688078 GGCAGGGGACGGGGGTGGGGAGG + Exonic
1029473462 7:100768760-100768782 GGCCTGGGAAGGGCCTCGGGGGG + Intronic
1029611160 7:101627337-101627359 GGCAGGGGCAGGGGCAGGGGTGG + Intronic
1029611415 7:101628554-101628576 GGGCTGGGCCAGGCCTGGTGGGG - Intronic
1030088883 7:105840104-105840126 GGCAGTGGCTGGGCCTGGGAGGG + Intronic
1030546915 7:110907503-110907525 GGGATGGGGCGGGCCATGGGTGG + Intronic
1032013525 7:128361524-128361546 GGCCGGGGCTGGGCCGGGGGCGG - Intronic
1032051065 7:128651428-128651450 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
1032051078 7:128651492-128651514 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
1032051505 7:128653406-128653428 GGCAAGGGCGGGGCCTGCAGAGG - Intergenic
1032391300 7:131556738-131556760 GGCCGGGGCCGGGGCTGGGCGGG + Intronic
1032756007 7:134891533-134891555 GGCGTGGGCTGGGCCCGCGGAGG - Intronic
1033037142 7:137885351-137885373 GACAGGGGCCAGGCCAGGGGCGG + Intronic
1033099724 7:138460190-138460212 GGCGGGGGCGGGGCCTGAGGTGG + Intergenic
1033165599 7:139036116-139036138 GGCCTGGGCCTGGCGAGGGGTGG + Intergenic
1033282825 7:140017854-140017876 GGCAGGGGCAGGGGCAGGGGTGG + Intronic
1033529077 7:142245101-142245123 GGCAAGGGCCAGGCCAGGGAAGG + Intergenic
1034345581 7:150383574-150383596 GGCATTGGCTGGGCATGGGCTGG + Intronic
1034345584 7:150383585-150383607 GGCATGGGCTGGGACTGGAGAGG + Intronic
1034618063 7:152436010-152436032 CGCAGGGGCCGGGCGGGGGGCGG + Intergenic
1034678753 7:152911861-152911883 GGAATGGGCGGGGGTTGGGGGGG + Intergenic
1034830644 7:154305016-154305038 GGCTGGGGCTGGGGCTGGGGAGG - Intronic
1035038992 7:155913953-155913975 CGCATGGGCAGGGCCTGGAGCGG + Intergenic
1035051430 7:156001149-156001171 GGCAAGGGCTGTGCCTGGGGAGG - Intergenic
1035266403 7:157692296-157692318 CGCCTGGGCCTGGCCTGGGGAGG - Intronic
1035398238 7:158548960-158548982 GGCGTTGGCCGTGCCTGGGCTGG - Intronic
1035553103 8:544921-544943 GGTTTGGGGCGGGCCTGGTGGGG - Intronic
1035579431 8:730985-731007 GGGATGGGTAGGGACTGGGGTGG + Intronic
1035853950 8:2952781-2952803 GGAATGGGCCAGGCCTGGCTGGG + Intronic
1035951343 8:4024969-4024991 GGCCTGGGCTAGGCCTGGGTGGG + Intronic
1036631971 8:10522218-10522240 GGGATGGGGCGGGCCGGGGGTGG - Intergenic
1036679213 8:10858621-10858643 GCCATGGGCCGTGCCTGTGTTGG + Intergenic
1037344702 8:17886465-17886487 GGCATGTGGGGGGCCTGGTGCGG + Intronic
1037368117 8:18144523-18144545 AACATGGGCCGGGCCGGGCGTGG - Intergenic
1037450780 8:19013922-19013944 GGCAGGGGCGGGGCCTCCGGGGG + Intronic
1037463206 8:19134266-19134288 TGAATTGGCCGGGCCGGGGGTGG - Intergenic
1038446119 8:27605413-27605435 GCCATGGGCAGGGCCTGGCCTGG - Intronic
1039478554 8:37854943-37854965 GGCAGGGGCGGGCCCTGAGGAGG - Intergenic
1039498672 8:38000208-38000230 GGCCTGGGCCGGGTATAGGGAGG - Intergenic
1039608483 8:38901416-38901438 TGCAGGGGCCGGGGCTCGGGCGG - Exonic
1040313629 8:46249584-46249606 GGCATGGGCGGGCCATAGGGTGG + Intergenic
1041839177 8:62248971-62248993 AGCCTGGGCCGGGCCGGGCGGGG + Exonic
1043463740 8:80486113-80486135 GGCTTGGGGCTGGGCTGGGGTGG - Intronic
1044242511 8:89902904-89902926 GGCCCGGGCCGGGACCGGGGTGG + Intronic
1044340422 8:91040756-91040778 GGCAGCGGCGGGGCCTGGGGAGG + Exonic
1045495036 8:102700868-102700890 GGCAGGGGCTGGGCCCTGGGAGG - Intergenic
1045850951 8:106697399-106697421 GGCAGGGGCAAGGCCTGGGGTGG + Intronic
1047998619 8:130358727-130358749 GGCGGGGGCCGGGCCGGGGGCGG - Intronic
1048345701 8:133572648-133572670 GGCAAGGGCTGGGCCAGGGCCGG - Intergenic
1048888917 8:138931094-138931116 GGGGTGGGCCGGGCCTTGGGAGG - Intergenic
1048898972 8:139020110-139020132 GGCATGGGCTGGGCCCCCGGAGG + Intergenic
1049056724 8:140242794-140242816 GGCACGGCACGGGCCAGGGGAGG + Intronic
1049059513 8:140265188-140265210 GGCCTGGGCGCGGCCTGGGGTGG - Intronic
1049107983 8:140625456-140625478 GTCAGGGGCTGGGGCTGGGGAGG - Intronic
1049109701 8:140635387-140635409 GGCAGGGGCCGGGGATCGGGGGG - Intronic
1049250126 8:141583769-141583791 GGCAGGGGCTGGGTCTGGGGAGG + Intergenic
1049359188 8:142203890-142203912 AGCAGGGGCGGGGCCAGGGGCGG + Intergenic
1049369964 8:142259704-142259726 GGCCTGCGCCGGTGCTGGGGTGG - Intronic
1049378590 8:142301157-142301179 GGCATGGGCAGGGCAAGTGGGGG - Intronic
1049378614 8:142301224-142301246 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049378636 8:142301286-142301308 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049378658 8:142301348-142301370 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049378682 8:142301415-142301437 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049378704 8:142301477-142301499 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049378729 8:142301544-142301566 GGCATGGGCAGGGCAGGTGGGGG - Intronic
1049396392 8:142403052-142403074 GGCCGGGGCCGGGCGTGGGGCGG - Intronic
1049407942 8:142460061-142460083 GGCTCGGGCCTGGCGTGGGGGGG + Intronic
1049475109 8:142793716-142793738 GTCCTGGGCAGGGCCTGGGGTGG + Intergenic
1049478228 8:142806757-142806779 GGCCTGGGCGGGGCCTGGAATGG + Intergenic
1049526082 8:143127609-143127631 GGCATGGGAGGGGCATGGGAGGG + Intergenic
1049556303 8:143283814-143283836 GGCATGGGGCGGGGCTTGCGGGG + Intergenic
1049597059 8:143489569-143489591 TGCCTGGGGCGGTCCTGGGGCGG - Intronic
1049601523 8:143509921-143509943 GGCATGTGCTGGACCTGGGAGGG - Intronic
1049643187 8:143724754-143724776 GGCTTGGGCCGGGCCTGTGCAGG + Exonic
1049645923 8:143735573-143735595 AGGATGGGCTGAGCCTGGGGCGG + Intergenic
1049651391 8:143771479-143771501 GTCCTCGGCCGGCCCTGGGGTGG - Intergenic
1049684475 8:143933860-143933882 GGCAGGGGCGGGGCATGTGGTGG - Intronic
1049684479 8:143933872-143933894 GGCAGGGGCAGGGGCAGGGGCGG - Intronic
1049686181 8:143940179-143940201 GGGAGGGGCCAGGCCTGGGGTGG - Intronic
1049688860 8:143950097-143950119 GGCCTGGGCCTGGGCTGGAGTGG - Intronic
1049792332 8:144477903-144477925 GTCGGGGGCGGGGCCTGGGGAGG - Intergenic
1049795847 8:144496985-144497007 GGCATGGGCCGGGGCAGGGAGGG - Exonic
1049929170 9:439516-439538 GGCAGGGGATGGGCCCGGGGAGG + Intronic
1051249546 9:15145633-15145655 GGCATGGGCCCAGGCTGGGGTGG - Intergenic
1051629371 9:19127730-19127752 GGCGGGGGCCCGGCCTGGGGAGG + Intronic
1052413217 9:28148021-28148043 GGCATGGCCAGGACCTGTGGCGG - Intronic
1053009192 9:34623809-34623831 GGCACGGGTTCGGCCTGGGGCGG - Intronic
1053163535 9:35829430-35829452 GCCATGGCCCGGGGCGGGGGCGG - Intronic
1056020394 9:82433073-82433095 GGCATGGCCAGGACCTGCGGTGG + Intergenic
1056511412 9:87309724-87309746 GGCATGGGGTGGGCATGGTGGGG - Intergenic
1056512863 9:87322172-87322194 GGCATTGGGTGGGCCTGAGGAGG - Intergenic
1056925144 9:90828238-90828260 GGCCTGGGCGGGGCGGGGGGGGG - Intronic
1057191018 9:93087727-93087749 GTCAGGGTCAGGGCCTGGGGTGG + Intergenic
1057199882 9:93134292-93134314 GGCCGGGGGCGGGCCGGGGGCGG - Intergenic
1057214650 9:93221039-93221061 GGTATTGGGTGGGCCTGGGGTGG + Intronic
1057552275 9:96060830-96060852 GGCAAGGGCAGGGCTTGGGCTGG - Intergenic
1057752402 9:97803484-97803506 GCGCTGGGCCGGGCCTGGGGAGG - Intergenic
1057786853 9:98094402-98094424 GACATGGGCAGGCCCTGGAGCGG + Intronic
1057952642 9:99382123-99382145 TGCATGGGCCTGGGTTGGGGAGG - Intergenic
1059230674 9:112718301-112718323 GGCGTGGCCCGGGGCGGGGGAGG + Intergenic
1060181534 9:121537785-121537807 AGCATGGACCGGACCTGGGTTGG + Intergenic
1060224418 9:121782553-121782575 GGCAGGGTCTCGGCCTGGGGAGG + Intronic
1060283483 9:122228863-122228885 GGCTGAGGCCGGGCCCGGGGCGG - Intronic
1060793035 9:126498448-126498470 GGCAGGGGCTGGGCCAGGTGAGG - Intronic
1060897030 9:127224913-127224935 GGCGTGGGCGGGGCGTGGGCGGG + Intronic
1060897035 9:127224924-127224946 GGCGTGGGCGGGGCGTGGGCGGG + Intronic
1060986990 9:127825579-127825601 GGCTGGGGCTGGGACTGGGGTGG + Intronic
1061027963 9:128062851-128062873 GGCCTGCGCTGTGCCTGGGGTGG + Exonic
1061047808 9:128176528-128176550 GGCAAGGCTGGGGCCTGGGGAGG + Intronic
1061086193 9:128400190-128400212 GGCAAGGGCCTGGCCTATGGAGG - Intergenic
1061211144 9:129194161-129194183 GGCACAGGCAGGGCTTGGGGAGG - Intergenic
1061453038 9:130678821-130678843 CGCATGGGCCGGGCATGGGTGGG + Intronic
1061609875 9:131739538-131739560 GCCAGGGGCCGGGCCGGGCGGGG - Intronic
1061799411 9:133105817-133105839 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061799418 9:133105829-133105851 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061799425 9:133105841-133105863 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061799432 9:133105853-133105875 GGCGGGGGCTGGGGCTGGGGCGG - Intronic
1061799442 9:133105871-133105893 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061799449 9:133105883-133105905 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061799456 9:133105895-133105917 GGCTGGGGCGGGGGCTGGGGCGG - Intronic
1061838679 9:133345300-133345322 GGGCTGGGCCGGGCCAGGGGTGG - Intronic
1061852078 9:133422277-133422299 GGCAGGGGCCGTGGCTAGGGTGG - Exonic
1061853277 9:133428576-133428598 GGCAGGGGCGGGGGCGGGGGTGG - Intronic
1061921192 9:133783459-133783481 GGCGTGGCCAGGGACTGGGGTGG + Intronic
1061988111 9:134142166-134142188 GGCATGGGGCGGGGGTGGGTGGG + Intronic
1062009426 9:134259122-134259144 GGCAGGGGGCAGCCCTGGGGAGG + Intergenic
1062048266 9:134434308-134434330 GGCATGGGCTGGGCCTGGGGAGG - Intronic
1062070643 9:134553430-134553452 AGCATGTGCCAGGCCTGGCGCGG + Intergenic
1062254644 9:135615202-135615224 GGCGTGGGCCGGGACAGGAGAGG - Intergenic
1062372254 9:136245938-136245960 CGCATGGGCGGGGGCGGGGGCGG - Intergenic
1062399797 9:136367370-136367392 GGCATGGAGGGGGCCTGGTGTGG - Intronic
1062442827 9:136578790-136578812 TTCAGGGGCCTGGCCTGGGGCGG + Intergenic
1062459043 9:136655243-136655265 GTCATGGCCAGGGCCTGGGGAGG + Intergenic
1062484008 9:136765141-136765163 GGGCTGGGCTGGCCCTGGGGAGG + Intronic
1062489135 9:136796042-136796064 GGCATGGGAGGGGCCAGGGAGGG + Intronic
1062495203 9:136828270-136828292 GGGCTGGGCCGGGCCTGGACAGG - Intronic
1062501726 9:136854695-136854717 TGCGTGGGCAGGGCCTGGGCCGG - Intronic
1062524721 9:136973578-136973600 GGCAGGGGCCAAGCCTGGGAGGG - Intergenic
1062527097 9:136982376-136982398 GGCACTGGCCGGGCATGGTGTGG - Intronic
1062532847 9:137009323-137009345 GGGCTGGGGCGGGCCCGGGGGGG - Intronic
1062536516 9:137023503-137023525 GGCCTGGGCTGGGGCTGGAGCGG - Intronic
1062542871 9:137049272-137049294 GGCATGGGCGCTGGCTGGGGAGG - Intronic
1062641478 9:137520908-137520930 CCCATGGGACGGGCATGGGGAGG + Intronic
1062641512 9:137521016-137521038 CCCATGGGACGGGCATGGGGAGG + Intronic
1062641532 9:137521071-137521093 CCCATGGGACGGGCATGGGGAGG + Intronic
1062754003 9:138277984-138278006 AGCATGAGCTGGGCCTGGTGAGG - Intergenic
1062754016 9:138278048-138278070 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
1062754198 9:138278797-138278819 GGCAAGGGCGGGGCCTGCAGAGG - Intergenic
1062754211 9:138278829-138278851 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1203577321 Un_KI270745v1:19593-19615 TGCATGAGCTGGGCCTGGTGAGG - Intergenic
1203577328 Un_KI270745v1:19625-19647 GGCAGAGGCTGGGCCTGGAGGGG - Intergenic
1203577771 Un_KI270745v1:21586-21608 GGCAAGAGCTGGGCCTGGAGAGG - Intergenic
1203654526 Un_KI270752v1:10093-10115 GGCAGGGGCTGGGGCTGGGGCGG + Intergenic
1186309156 X:8298759-8298781 GGCATGATCCGGGCCTGGCGGGG - Intergenic
1186455017 X:9703903-9703925 GGCATGGTCCAGCCCTGTGGAGG + Intronic
1186466234 X:9786345-9786367 GGCCGGGGCCGGGGCTGGCGGGG - Intergenic
1189199016 X:39175712-39175734 GGCATCGGCTTGGACTGGGGAGG + Intergenic
1189337135 X:40176776-40176798 GACAAGGGCCGGGCCGGGCGGGG - Intronic
1189472251 X:41323097-41323119 GGCTTGGGGGGGGCATGGGGTGG + Intergenic
1190337266 X:49270034-49270056 GCCGTGGGGCGGGCCCGGGGCGG + Exonic
1190380684 X:49837177-49837199 GGGAAGGGCAGGACCTGGGGTGG + Intergenic
1190888634 X:54550802-54550824 GGCTTTGTCAGGGCCTGGGGTGG + Intronic
1192795217 X:74420677-74420699 GGTCTGGGCCGGGCCAGGGCCGG - Intergenic
1192795231 X:74420704-74420726 GGTCTGGGCCGGGCCAGGGCCGG - Intergenic
1192873063 X:75203656-75203678 TGGATGGGCAGGGTCTGGGGGGG + Intergenic
1194531505 X:95055132-95055154 GGCATTGGCGGGGGATGGGGAGG - Intergenic
1195228350 X:102821168-102821190 GGCTTGGGCGGGGGTTGGGGGGG - Intergenic
1195625105 X:106999563-106999585 GGGGCGGGCCGGGGCTGGGGTGG - Intronic
1197768127 X:130072166-130072188 GGGATGGGCGGGGCGTGGGGGGG - Intronic
1199767522 X:150952140-150952162 GGCAGGGGCAGGGCCTGGCCAGG + Intergenic
1199846292 X:151694943-151694965 GGCACGGGCGGGGGCAGGGGCGG + Intergenic
1200065155 X:153501276-153501298 GGCAGGGGCCAGGCTTTGGGAGG + Intronic
1200154896 X:153970210-153970232 GGCTGGGGCTGGGGCTGGGGCGG - Intronic
1200161606 X:154012665-154012687 GCCAAGGGCCAGTCCTGGGGTGG + Exonic
1200209658 X:154341606-154341628 GGCCGGGGCCGGGGCCGGGGCGG + Intergenic
1200221194 X:154390486-154390508 GGCCGGGGCCGGGGCCGGGGCGG - Intronic