ID: 1202872660

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:177986-178008
Sequence GCCGGGCCTGGGGTGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872643_1202872660 13 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872649_1202872660 -3 Left 1202872649 14_GL000225v1_random:177966-177988 CCCTCCGAGCCCGGGCATGGGCC No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872639_1202872660 25 Left 1202872639 14_GL000225v1_random:177938-177960 CCTGCTGGCAGGCCTCGCACCAG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872650_1202872660 -4 Left 1202872650 14_GL000225v1_random:177967-177989 CCTCCGAGCCCGGGCATGGGCCG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872644_1202872660 6 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872653_1202872660 -7 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data
1202872638_1202872660 26 Left 1202872638 14_GL000225v1_random:177937-177959 CCCTGCTGGCAGGCCTCGCACCA No data
Right 1202872660 14_GL000225v1_random:177986-178008 GCCGGGCCTGGGGTGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872660 Original CRISPR GCCGGGCCTGGGGTGGTCCC TGG Intergenic
No off target data available for this crispr