ID: 1202872663

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:178000-178022
Sequence GGTCCCTGGAGCCCCCCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872644_1202872663 20 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872653_1202872663 7 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872649_1202872663 11 Left 1202872649 14_GL000225v1_random:177966-177988 CCCTCCGAGCCCGGGCATGGGCC No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872655_1202872663 2 Left 1202872655 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872657_1202872663 1 Left 1202872657 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872643_1202872663 27 Left 1202872643 14_GL000225v1_random:177950-177972 CCTCGCACCAGGGGCTCCCTCCG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872661_1202872663 -10 Left 1202872661 14_GL000225v1_random:177987-178009 CCGGGCCTGGGGTGGTCCCTGGA No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data
1202872650_1202872663 10 Left 1202872650 14_GL000225v1_random:177967-177989 CCTCCGAGCCCGGGCATGGGCCG No data
Right 1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872663 Original CRISPR GGTCCCTGGAGCCCCCCTGA CGG Intergenic
No off target data available for this crispr