ID: 1202872663 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14_GL000225v1_random:178000-178022 |
Sequence | GGTCCCTGGAGCCCCCCTGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 8 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202872663 | Original CRISPR | GGTCCCTGGAGCCCCCCTGA CGG | Intergenic | ||