ID: 1202872667

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000225v1_random:178009-178031
Sequence AGCCCCCCTGACGGGAAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 3, 1: 0, 2: 1, 3: 3, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202872662_1202872667 -6 Left 1202872662 14_GL000225v1_random:177992-178014 CCTGGGGTGGTCCCTGGAGCCCC No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872655_1202872667 11 Left 1202872655 14_GL000225v1_random:177975-177997 CCCGGGCATGGGCCGGGCCTGGG No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872657_1202872667 10 Left 1202872657 14_GL000225v1_random:177976-177998 CCGGGCATGGGCCGGGCCTGGGG No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872650_1202872667 19 Left 1202872650 14_GL000225v1_random:177967-177989 CCTCCGAGCCCGGGCATGGGCCG No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872661_1202872667 -1 Left 1202872661 14_GL000225v1_random:177987-178009 CCGGGCCTGGGGTGGTCCCTGGA No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872649_1202872667 20 Left 1202872649 14_GL000225v1_random:177966-177988 CCCTCCGAGCCCGGGCATGGGCC No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872653_1202872667 16 Left 1202872653 14_GL000225v1_random:177970-177992 CCGAGCCCGGGCATGGGCCGGGC No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63
1202872644_1202872667 29 Left 1202872644 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG No data
Right 1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG 0: 3
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202872667 Original CRISPR AGCCCCCCTGACGGGAAGCG TGG Intergenic
900423674 1:2566623-2566645 AGTCCCCTTGACAGGAGGCGCGG - Intergenic
906207704 1:43995976-43995998 AACCCCGCAGAGGGGAAGCGGGG - Exonic
910251173 1:85200848-85200870 TGCCCCCGGGACGGGGAGCGGGG - Exonic
911058016 1:93724176-93724198 AGCCCCACAGAGGGGAACCGAGG + Intronic
1065329402 10:24578798-24578820 TGCACCCCAGAGGGGAAGCGGGG + Intergenic
1075595038 10:123723069-123723091 AGCGCCCTTGACCGGAAGCAGGG - Intronic
1075885385 10:125895908-125895930 AGCCCCCCTGACGGGAAGCGTGG - Intronic
1083968740 11:66059348-66059370 AGCCCTCCTGGTGGGAAGCAGGG + Intronic
1089467508 11:118694945-118694967 ATCCCCCGTGGCGGGCAGCGAGG + Intergenic
1092140491 12:6180292-6180314 AGCCACCCTGACAGGCAGCATGG + Intergenic
1094496526 12:30992531-30992553 AGCCGCCCTGGCAGGAAGCAGGG + Exonic
1101412091 12:104478069-104478091 AACCCCCCTAACAGGAAGTGGGG + Intronic
1104591180 12:130085692-130085714 AGCCCTCGTGCAGGGAAGCGTGG - Intergenic
1110305659 13:73984247-73984269 AGCCACCCTGGCGGGACTCGGGG + Intronic
1111660019 13:91197980-91198002 AGCCATCCTAACGGGAAGTGAGG - Intergenic
1202872667 14_GL000225v1_random:178009-178031 AGCCCCCCTGACGGGAAGCGTGG + Intergenic
1125651483 15:41321129-41321151 AGCCACCCTGTCGGGGAGGGAGG + Intronic
1130728624 15:86467074-86467096 AGACCCCCTGAGGGAAAGGGTGG - Intronic
1133036151 16:3035456-3035478 AGCGGCCCGGACGGGAAGCTGGG + Exonic
1136147412 16:28323507-28323529 AGCCCCCTGGATGGGAGGCGGGG + Exonic
1138458121 16:57132889-57132911 AGCCCCCCTGACCGCAAGGCTGG + Intronic
1138642578 16:58397029-58397051 AGCCGCCCTGTCCGGAAGGGAGG - Intronic
1138689498 16:58754095-58754117 AGCTGCCCCGACGGGAAGCAGGG - Intergenic
1141754758 16:85983697-85983719 AGCCCACCGGAAGGGCAGCGGGG + Intergenic
1142151199 16:88513221-88513243 AGCCCCCAGGAAGGGAAGAGCGG - Intronic
1142191366 16:88719732-88719754 AGCCCACCTGACGGGAACCCTGG - Intronic
1142499902 17:326453-326475 AGCCCCTCTGAGGGACAGCGAGG + Intronic
1142583311 17:955053-955075 AGCCCCCGCGACGGGGAGAGTGG + Intronic
1144510041 17:15867597-15867619 AGCCACCCCGTCGGGAAGGGAGG + Intergenic
1147184476 17:38705849-38705871 ACCCCACCTGAAGGGAAGGGAGG + Intronic
1150311019 17:64129773-64129795 AGCTTCCCTGACGGGAGTCGCGG - Intronic
1160766697 19:811951-811973 AGCCCCCGGGACAGGACGCGGGG - Exonic
1160897089 19:1408015-1408037 ATCCCCCAGGACGGGAAGCCGGG - Intronic
1161109655 19:2462192-2462214 GGCCCCACCCACGGGAAGCGCGG - Intergenic
1161241172 19:3224742-3224764 GGCCCGCCTGACGGAGAGCGAGG + Exonic
1164747657 19:30628000-30628022 AGCCCTCCCCACGGGAAGCAGGG - Intronic
1165124399 19:33583513-33583535 AGACCCCCTATAGGGAAGCGGGG - Intergenic
1165791837 19:38497163-38497185 CTGCCCCCAGACGGGAAGCGTGG - Intronic
1168696114 19:58405231-58405253 AGCCGCCCTGTCCGGAAGGGAGG - Intronic
927491008 2:23521000-23521022 AACACCCCTGAGGGGGAGCGGGG - Intronic
927725343 2:25417924-25417946 AGCCCCCTTGAGGTGAAGTGTGG + Intronic
930046358 2:47176243-47176265 AGCCCCCCTGAAGAGAATGGGGG + Intronic
935203389 2:100877567-100877589 AGCCCACCTGAGGGGAGGGGAGG - Intronic
936404968 2:112194743-112194765 AAACCCACTGACGGGAAGCCAGG - Intergenic
946403518 2:219481109-219481131 AGCCCCCCTGATGGGCAGGGAGG - Intronic
1175994393 20:62805588-62805610 GGCCCCCCTGTCGGGGAGCTGGG + Intronic
1180159599 21:45993144-45993166 AGTACCCCAGACGGGAAGCTAGG + Intronic
1180285429 22:10741467-10741489 AACCCCCCTGACGGGAAGCATGG - Intergenic
1182428920 22:30289069-30289091 AGCCCCTCTGACATGAAGGGAGG + Intronic
952152508 3:30607460-30607482 AGCCGGCCTGAGGGAAAGCGTGG - Intronic
954080913 3:48211964-48211986 AGCCGCCCTGTCGGGGAGGGAGG + Intergenic
969711992 4:8849888-8849910 GGCCCCCCTGACAGGAAGCAAGG - Intronic
989375513 5:40756144-40756166 TTCCCCACTGACGGGACGCGAGG - Intergenic
999604141 5:153296887-153296909 AGCCCCCCTGTCCGGGAGGGAGG - Intergenic
999767958 5:154755391-154755413 AGCCCCCGAGCCGGGAAGCCCGG + Intronic
1005909028 6:30292087-30292109 AGCCCCTCTGTGGGGATGCGTGG - Intergenic
1018910224 6:168097461-168097483 AGCCCCGCTGACGGGACAGGTGG + Intergenic
1019291692 7:253650-253672 AGCCCCTCGCCCGGGAAGCGGGG - Intronic
1021855251 7:24848967-24848989 AGCACCCATGAGGGGAAGCAGGG + Intronic
1024044050 7:45575396-45575418 AGCGCCCCTGGCGTGAAGTGTGG + Intronic
1027188302 7:75984452-75984474 AGCCCGCCTGTAGGGAAGCCTGG + Intronic
1032501304 7:132402304-132402326 AGACACCCTGACGGTAGGCGGGG + Intronic
1033299902 7:140176589-140176611 AGCCCCCCGGCCGGGCAGTGGGG - Intronic
1034723478 7:153315217-153315239 AGCCTCCCGGACGGGAGGTGAGG - Intergenic
1044923237 8:97187627-97187649 AGCCCCACTGATAGGAAGAGAGG + Intergenic
1044942091 8:97353802-97353824 AGCCACCATGACGGGAAGATTGG + Intergenic
1060350224 9:122852607-122852629 AGCCGCCCTGACCGGGAGGGAGG + Intronic
1203731792 Un_GL000216v2:98534-98556 AGCCCCCCTGACGGGAAGCGTGG - Intergenic
1187242604 X:17527440-17527462 AGCCCTCTTGACTGGAAGCTGGG + Intronic
1192584009 X:72306256-72306278 CGCCCCCCTGCCGGCCAGCGGGG - Intronic