ID: 1202887007

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270722v1_random:117180-117202
Sequence GGTCTGACTGTCCCTCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202887007_1202887011 10 Left 1202887007 14_KI270722v1_random:117180-117202 CCTATGTGAGGGACAGTCAGACC No data
Right 1202887011 14_KI270722v1_random:117213-117235 TGTTATGGAATCCTATTTGAGGG No data
1202887007_1202887012 11 Left 1202887007 14_KI270722v1_random:117180-117202 CCTATGTGAGGGACAGTCAGACC No data
Right 1202887012 14_KI270722v1_random:117214-117236 GTTATGGAATCCTATTTGAGGGG No data
1202887007_1202887010 9 Left 1202887007 14_KI270722v1_random:117180-117202 CCTATGTGAGGGACAGTCAGACC No data
Right 1202887010 14_KI270722v1_random:117212-117234 GTGTTATGGAATCCTATTTGAGG No data
1202887007_1202887008 -5 Left 1202887007 14_KI270722v1_random:117180-117202 CCTATGTGAGGGACAGTCAGACC No data
Right 1202887008 14_KI270722v1_random:117198-117220 AGACCACAGCAGCAGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202887007 Original CRISPR GGTCTGACTGTCCCTCACAT AGG (reversed) Intergenic
No off target data available for this crispr