ID: 1202889267

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270722v1_random:140450-140472
Sequence TGCACTAATCCCAATCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202889265_1202889267 -10 Left 1202889265 14_KI270722v1_random:140437-140459 CCTCTTTCATAAGTGCACTAATC No data
Right 1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG No data
1202889262_1202889267 27 Left 1202889262 14_KI270722v1_random:140400-140422 CCTCTCATGTTGGAATGGACAAA No data
Right 1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG No data
1202889264_1202889267 -3 Left 1202889264 14_KI270722v1_random:140430-140452 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202889267 Original CRISPR TGCACTAATCCCAATCAGGA TGG Intergenic
No off target data available for this crispr