ID: 1202891077

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270722v1_random:158634-158656
Sequence CAGGGCCACCTGCAGTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202891072_1202891077 6 Left 1202891072 14_KI270722v1_random:158605-158627 CCACCTCTTGTGGAGGGCCTGAT 0: 6
1: 183
2: 125
3: 58
4: 139
Right 1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG No data
1202891073_1202891077 3 Left 1202891073 14_KI270722v1_random:158608-158630 CCTCTTGTGGAGGGCCTGATATC No data
Right 1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202891077 Original CRISPR CAGGGCCACCTGCAGTTATC TGG Intergenic
No off target data available for this crispr