ID: 1202900215

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32189-32211
Sequence TGGCCACTATTCAGTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900215_1202900221 5 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900221 14_GL000194v1_random:32217-32239 GCTGCTCCAGGCTCCAGCAGAGG No data
1202900215_1202900223 13 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900223 14_GL000194v1_random:32225-32247 AGGCTCCAGCAGAGGAAGACCGG No data
1202900215_1202900218 -7 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900218 14_GL000194v1_random:32205-32227 GTGGCCATTCCAGCTGCTCCAGG No data
1202900215_1202900228 22 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900215_1202900224 14 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900224 14_GL000194v1_random:32226-32248 GGCTCCAGCAGAGGAAGACCGGG No data
1202900215_1202900225 15 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900225 14_GL000194v1_random:32227-32249 GCTCCAGCAGAGGAAGACCGGGG No data
1202900215_1202900227 19 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900215 Original CRISPR TGGCCACTATTCAGTCACAG GGG (reversed) Intergenic
No off target data available for this crispr