ID: 1202900216

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32190-32212
Sequence ATGGCCACTATTCAGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900216_1202900221 4 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900221 14_GL000194v1_random:32217-32239 GCTGCTCCAGGCTCCAGCAGAGG No data
1202900216_1202900227 18 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900216_1202900218 -8 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900218 14_GL000194v1_random:32205-32227 GTGGCCATTCCAGCTGCTCCAGG No data
1202900216_1202900228 21 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900216_1202900223 12 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900223 14_GL000194v1_random:32225-32247 AGGCTCCAGCAGAGGAAGACCGG No data
1202900216_1202900225 14 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900225 14_GL000194v1_random:32227-32249 GCTCCAGCAGAGGAAGACCGGGG No data
1202900216_1202900224 13 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900224 14_GL000194v1_random:32226-32248 GGCTCCAGCAGAGGAAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900216 Original CRISPR ATGGCCACTATTCAGTCACA GGG (reversed) Intergenic
No off target data available for this crispr