ID: 1202900217

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32191-32213
Sequence AATGGCCACTATTCAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900217_1202900223 11 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900223 14_GL000194v1_random:32225-32247 AGGCTCCAGCAGAGGAAGACCGG No data
1202900217_1202900225 13 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900225 14_GL000194v1_random:32227-32249 GCTCCAGCAGAGGAAGACCGGGG No data
1202900217_1202900224 12 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900224 14_GL000194v1_random:32226-32248 GGCTCCAGCAGAGGAAGACCGGG No data
1202900217_1202900230 30 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900217_1202900221 3 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900221 14_GL000194v1_random:32217-32239 GCTGCTCCAGGCTCCAGCAGAGG No data
1202900217_1202900227 17 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900217_1202900218 -9 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900218 14_GL000194v1_random:32205-32227 GTGGCCATTCCAGCTGCTCCAGG No data
1202900217_1202900228 20 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900217 Original CRISPR AATGGCCACTATTCAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr