ID: 1202900220

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32214-32236
Sequence CTGCTGGAGCCTGGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900220_1202900230 7 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900220_1202900231 8 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data
1202900220_1202900234 24 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900234 14_GL000194v1_random:32261-32283 ACCAGGGTGATCCTCAGGTCTGG No data
1202900220_1202900227 -6 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900220_1202900225 -10 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900225 14_GL000194v1_random:32227-32249 GCTCCAGCAGAGGAAGACCGGGG No data
1202900220_1202900228 -3 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900220_1202900232 19 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900232 14_GL000194v1_random:32256-32278 GCTCCACCAGGGTGATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900220 Original CRISPR CTGCTGGAGCCTGGAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr