ID: 1202900226

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32230-32252
Sequence CTACCCCGGTCTTCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900226_1202900237 27 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900237 14_GL000194v1_random:32280-32302 CTGGCGCTCACACATTCCAGAGG No data
1202900226_1202900234 8 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900234 14_GL000194v1_random:32261-32283 ACCAGGGTGATCCTCAGGTCTGG No data
1202900226_1202900230 -9 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900226_1202900231 -8 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data
1202900226_1202900232 3 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900232 14_GL000194v1_random:32256-32278 GCTCCACCAGGGTGATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900226 Original CRISPR CTACCCCGGTCTTCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr