ID: 1202900227

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32231-32253
Sequence CAGCAGAGGAAGACCGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900215_1202900227 19 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900216_1202900227 18 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900219_1202900227 -1 Left 1202900219 14_GL000194v1_random:32209-32231 CCATTCCAGCTGCTCCAGGCTCC No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900217_1202900227 17 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data
1202900220_1202900227 -6 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900227 Original CRISPR CAGCAGAGGAAGACCGGGGT AGG Intergenic
No off target data available for this crispr