ID: 1202900228

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32234-32256
Sequence CAGAGGAAGACCGGGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900216_1202900228 21 Left 1202900216 14_GL000194v1_random:32190-32212 CCCTGTGACTGAATAGTGGCCAT No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900220_1202900228 -3 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900215_1202900228 22 Left 1202900215 14_GL000194v1_random:32189-32211 CCCCTGTGACTGAATAGTGGCCA No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900219_1202900228 2 Left 1202900219 14_GL000194v1_random:32209-32231 CCATTCCAGCTGCTCCAGGCTCC No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data
1202900217_1202900228 20 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900228 14_GL000194v1_random:32234-32256 CAGAGGAAGACCGGGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900228 Original CRISPR CAGAGGAAGACCGGGGTAGG TGG Intergenic
No off target data available for this crispr