ID: 1202900230

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32244-32266
Sequence CCGGGGTAGGTGGCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900222_1202900230 -2 Left 1202900222 14_GL000194v1_random:32223-32245 CCAGGCTCCAGCAGAGGAAGACC No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900217_1202900230 30 Left 1202900217 14_GL000194v1_random:32191-32213 CCTGTGACTGAATAGTGGCCATT No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900219_1202900230 12 Left 1202900219 14_GL000194v1_random:32209-32231 CCATTCCAGCTGCTCCAGGCTCC No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900226_1202900230 -9 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data
1202900220_1202900230 7 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900230 14_GL000194v1_random:32244-32266 CCGGGGTAGGTGGCTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900230 Original CRISPR CCGGGGTAGGTGGCTCCACC AGG Intergenic
No off target data available for this crispr