ID: 1202900231

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:32245-32267
Sequence CGGGGTAGGTGGCTCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202900220_1202900231 8 Left 1202900220 14_GL000194v1_random:32214-32236 CCAGCTGCTCCAGGCTCCAGCAG No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data
1202900226_1202900231 -8 Left 1202900226 14_GL000194v1_random:32230-32252 CCAGCAGAGGAAGACCGGGGTAG No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data
1202900222_1202900231 -1 Left 1202900222 14_GL000194v1_random:32223-32245 CCAGGCTCCAGCAGAGGAAGACC No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data
1202900219_1202900231 13 Left 1202900219 14_GL000194v1_random:32209-32231 CCATTCCAGCTGCTCCAGGCTCC No data
Right 1202900231 14_GL000194v1_random:32245-32267 CGGGGTAGGTGGCTCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202900231 Original CRISPR CGGGGTAGGTGGCTCCACCA GGG Intergenic
No off target data available for this crispr