ID: 1202904332

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:59776-59798
Sequence CCATGCTGCCTGGCAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202904325_1202904332 -5 Left 1202904325 14_GL000194v1_random:59758-59780 CCTGAAAGCCACCCAGGGCCATG No data
Right 1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG No data
1202904320_1202904332 14 Left 1202904320 14_GL000194v1_random:59739-59761 CCTGTGCTGCCGAGGCTGCCCTG No data
Right 1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG No data
1202904324_1202904332 -4 Left 1202904324 14_GL000194v1_random:59757-59779 CCCTGAAAGCCACCCAGGGCCAT No data
Right 1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG No data
1202904321_1202904332 5 Left 1202904321 14_GL000194v1_random:59748-59770 CCGAGGCTGCCCTGAAAGCCACC No data
Right 1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202904332 Original CRISPR CCATGCTGCCTGGCAGAGGC TGG Intergenic
No off target data available for this crispr