ID: 1202904595

View in Genome Browser
Species Human (GRCh38)
Location 14_GL000194v1_random:60869-60891
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 5, 1: 1, 2: 3, 3: 27, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202904595_1202904608 15 Left 1202904595 14_GL000194v1_random:60869-60891 CCTGCCAGCTGCAAACTCCCAAA 0: 5
1: 1
2: 3
3: 27
4: 319
Right 1202904608 14_GL000194v1_random:60907-60929 ATGGGGTGAAGACACCCTGAAGG No data
1202904595_1202904600 -3 Left 1202904595 14_GL000194v1_random:60869-60891 CCTGCCAGCTGCAAACTCCCAAA 0: 5
1: 1
2: 3
3: 27
4: 319
Right 1202904600 14_GL000194v1_random:60889-60911 AAAGCCCCCAGCCCTCTCATGGG 0: 5
1: 1
2: 0
3: 18
4: 180
1202904595_1202904601 -2 Left 1202904595 14_GL000194v1_random:60869-60891 CCTGCCAGCTGCAAACTCCCAAA 0: 5
1: 1
2: 3
3: 27
4: 319
Right 1202904601 14_GL000194v1_random:60890-60912 AAGCCCCCAGCCCTCTCATGGGG 0: 5
1: 2
2: 1
3: 19
4: 219
1202904595_1202904599 -4 Left 1202904595 14_GL000194v1_random:60869-60891 CCTGCCAGCTGCAAACTCCCAAA 0: 5
1: 1
2: 3
3: 27
4: 319
Right 1202904599 14_GL000194v1_random:60888-60910 CAAAGCCCCCAGCCCTCTCATGG 0: 5
1: 1
2: 0
3: 19
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202904595 Original CRISPR TTTGGGAGTTTGCAGCTGGC AGG (reversed) Intergenic
900665278 1:3811005-3811027 GGTGGGAGTTTGCAGCTGGGTGG + Intergenic
902344567 1:15806578-15806600 TTTGGGAGGTTGAGGCAGGCGGG + Intergenic
902549846 1:17212711-17212733 TTTGGGAGTGGGCAGGGGGCTGG + Intronic
902554950 1:17241349-17241371 TTGGGGTGTTGGCAGCTGGCAGG + Intronic
902588881 1:17459353-17459375 TTTGGGAGGCTGGGGCTGGCAGG + Intergenic
903346601 1:22688946-22688968 TTTGGGAGGCTGAGGCTGGCAGG + Intergenic
904049996 1:27633267-27633289 TTTGGGAGTTGGCAACCTGCAGG - Intronic
904509039 1:30986195-30986217 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
905067958 1:35199652-35199674 TTTGGGAGGCTGAGGCTGGCAGG - Intergenic
905181270 1:36168507-36168529 TAAAGGAGTTTGCAGTTGGCTGG + Intronic
906291796 1:44624168-44624190 TCTGTGAGTCTGCAGCTGCCTGG - Intronic
906505289 1:46374365-46374387 TTTGGGAGTCTGAGGCAGGCAGG + Intergenic
908163270 1:61432754-61432776 CTTGGGAGTTTGCAGCTGTGAGG - Intronic
908479380 1:64522547-64522569 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
911210578 1:95134365-95134387 TATGGGTGTTTGCAGTGGGCAGG + Intronic
912450176 1:109763655-109763677 CTTGGGACTCAGCAGCTGGCTGG - Intronic
912703735 1:111896993-111897015 TTAAGGAGTTTGCAGTTTGCAGG - Intronic
912890237 1:113522345-113522367 TTTGGGAGATTGAGGCAGGCAGG - Intronic
914773563 1:150715025-150715047 TTTGGGAGGTTGAGGCAGGCGGG - Intronic
914818246 1:151079296-151079318 TTTGGGAGGCTGAGGCTGGCGGG + Intronic
915435423 1:155901867-155901889 TTTGGGAGGCTGAAGCAGGCAGG + Intronic
917551970 1:176041869-176041891 TTTGGGAGGTTGAGGCAGGCAGG + Intronic
917773297 1:178304279-178304301 TTTGGGAGGCTGAAGCTGGAGGG + Intronic
918996583 1:191769178-191769200 TTTGGGAGGTTGAGGCGGGCGGG - Intergenic
919864644 1:201771266-201771288 TTTGGGAGGCTGAAGCAGGCAGG + Intronic
920156642 1:203957430-203957452 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
920163122 1:204015184-204015206 TTTGGGAGTCTGAGGCAGGCAGG + Intergenic
920666766 1:207968617-207968639 TTTGGGAGGCTGAAGCTGGAGGG + Intergenic
922165631 1:223113446-223113468 TTTGGGAGGTTGAGGCAGGCAGG - Intronic
924324299 1:242880058-242880080 TTTGGGAGTATGCAGTAGGGTGG + Intergenic
924371232 1:243352453-243352475 TTTGCAAGTTGGCAGTTGGCTGG - Intronic
924679807 1:246220353-246220375 TTTGGGAGGCTGCAGGTGCCTGG - Intronic
1063644288 10:7863366-7863388 TTTGGGAGGTTGAGGCAGGCAGG + Intronic
1063904685 10:10769518-10769540 TTTGGGAGGCTGAGGCTGGCAGG + Intergenic
1065920042 10:30385268-30385290 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1068004804 10:51380555-51380577 TTTGGGAGACTGAGGCTGGCAGG + Intronic
1068814701 10:61296337-61296359 TTTGTGAGTTGGCAGCTTGCTGG - Intergenic
1069169261 10:65204638-65204660 TTTGGGAGACTGAGGCTGGCGGG + Intergenic
1069373900 10:67774473-67774495 TTTGGGAGGCTGAAGCAGGCGGG + Intergenic
1069505963 10:68998191-68998213 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
1070331458 10:75420462-75420484 TTTGGGAGTCTTCAGCTTTCAGG - Intergenic
1070727910 10:78804564-78804586 TCTGAGAGTTTGCATCTGGAGGG + Intergenic
1071538770 10:86459869-86459891 TTTGGGAGGCTGAAGCCGGCAGG + Intronic
1074119842 10:110485874-110485896 TTTGGGAGATTGCGGATGGAGGG - Intergenic
1074839423 10:117334253-117334275 TTTGGGAGGTTGAAGCTGGTGGG + Intronic
1074999659 10:118786263-118786285 TTTGGGAGGTTGAGGCAGGCGGG + Intergenic
1075147324 10:119893098-119893120 TTTGGGATCTTGGAGGTGGCAGG + Intronic
1075635904 10:124030084-124030106 CTTGGGAGTTTTCAGCTTGGTGG + Intronic
1076250283 10:128979482-128979504 ACTGGGAGCTGGCAGCTGGCTGG - Intergenic
1076871707 10:133197930-133197952 TTTGGGAGATGGGGGCTGGCAGG - Intronic
1077029464 11:457797-457819 TTTGGGAGTATGTGGCTGGCTGG + Intronic
1077453640 11:2665245-2665267 TCAGGGAGTTTGAGGCTGGCAGG - Intronic
1078836499 11:15035288-15035310 TTTGGGTGGTGGCAGCTGGGAGG + Intronic
1080930813 11:36808213-36808235 TTTGGTAGCTTTCAGCTGTCTGG + Intergenic
1083089948 11:60189521-60189543 GTTGGGAGATGGCAGCTGGATGG - Intergenic
1084663334 11:70560112-70560134 TTTGGGAGTCTGAGGCGGGCAGG - Intronic
1088689709 11:112315317-112315339 TTTAGGCATTTACAGCTGGCAGG + Intergenic
1089430726 11:118422274-118422296 TTTGGGAGGCTGAAGCAGGCAGG - Intronic
1090083330 11:123629099-123629121 TATGGGAATTTGAAGCAGGCTGG + Intergenic
1090259006 11:125305409-125305431 TCAGGGAGTTCGCAGCAGGCTGG - Intronic
1090924083 11:131234416-131234438 CTCGGGAGTGTGCAGCTGCCAGG + Intergenic
1091258412 11:134212632-134212654 TTTGGGAGGCTGCTGCCGGCAGG - Intronic
1093201835 12:16196975-16196997 TTTGGGAGTTTGTGGGTGACAGG + Intronic
1093356851 12:18177039-18177061 TTTGGGAGATGGAAGCTGGATGG - Intronic
1094131567 12:27080949-27080971 TTTGGGAGGCTGCGGCAGGCAGG - Intergenic
1099203526 12:79702569-79702591 TTTGGGAGGCTGCAGCAGGCAGG - Intergenic
1100435950 12:94571844-94571866 TTTGGGGATTTGCAGCCGCCTGG - Intronic
1100561900 12:95755430-95755452 TGTGGGCGTCTGCAGCTGGTTGG + Intronic
1101384554 12:104245267-104245289 TTTGGGAGGCTGCGGCAGGCGGG + Intronic
1101557482 12:105823955-105823977 TGTGCGATTGTGCAGCTGGCAGG - Intergenic
1102341998 12:112128792-112128814 TTTGGGAGGCTGAGGCTGGCTGG + Intronic
1102399579 12:112616840-112616862 TTTGGGAGCCTGCAGCTTCCTGG + Intronic
1102663231 12:114547701-114547723 CTTGGGGGTGTGCAGCAGGCTGG - Intergenic
1102764823 12:115423372-115423394 CCTGGGAGTTTGTAGGTGGCAGG - Intergenic
1102829067 12:115978567-115978589 TTTGGGAGGCTGAGGCTGGCGGG - Intronic
1102929505 12:116851494-116851516 TTTGGGAGGCTGAAGCAGGCGGG + Exonic
1103301660 12:119932311-119932333 TTTGGGAGGGTGAAGCAGGCGGG + Intergenic
1107556765 13:41522496-41522518 TTTGGGAGGTTGAGGCAGGCAGG + Intergenic
1112497691 13:99917774-99917796 TTTGGGAGGCTGAAGCGGGCAGG + Intergenic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1114007035 14:18325054-18325076 TCTGGAAGTTTGCAGCGGGGAGG + Intergenic
1114782033 14:25548593-25548615 GGTGGGAGTATGCAGCTGGTAGG + Intergenic
1115675665 14:35670626-35670648 TTTGAGAGTTTACTCCTGGCTGG + Intronic
1115722216 14:36175520-36175542 TTTGAGTTTTTGCAACTGGCTGG - Intergenic
1118093392 14:62508608-62508630 TTTTGAAGTTTACAACTGGCTGG + Intergenic
1119143272 14:72287054-72287076 TGTGGTAGTTTGCACCTGGGAGG - Intronic
1119382506 14:74238266-74238288 TTTGGGGGTTTGCACCTGACTGG + Intergenic
1120999167 14:90439027-90439049 TTTGGGAGGTTGAGGCGGGCGGG + Intergenic
1121446406 14:93981733-93981755 CTGGGCTGTTTGCAGCTGGCTGG + Intergenic
1121526270 14:94621558-94621580 AGGGGGAGTTTGCAGGTGGCAGG + Intronic
1121938459 14:98043800-98043822 CTTGGGAGATTCCAGCAGGCTGG - Intergenic
1122223295 14:100256027-100256049 CTTGGGAGGTTGCAGCAGGAGGG + Intronic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1122561244 14:102616082-102616104 TCTTGAAATTTGCAGCTGGCTGG - Intronic
1202904595 14_GL000194v1_random:60869-60891 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1202938613 14_KI270725v1_random:119120-119142 TTTGGAAAGTTGCAGCTGGGAGG - Intergenic
1124044475 15:26135806-26135828 TTTGGGAGGTTGCTGTGGGCTGG - Intergenic
1124054945 15:26233677-26233699 TTTGGGAGGATGAAGCAGGCAGG - Intergenic
1124454944 15:29833633-29833655 TTTGGGAGGTTAGAGCAGGCAGG - Intronic
1124851418 15:33342227-33342249 TATGGAAATTTGCAGATGGCAGG - Intronic
1125248615 15:37672888-37672910 GTTGGGAGTTTCCAGCTCTCAGG - Intergenic
1128503315 15:68245318-68245340 TTTGGGAGGCTGAGGCTGGCAGG + Intronic
1128609137 15:69059899-69059921 TTGGGGAGTTTGCAGCTTCATGG - Intronic
1129484424 15:75855943-75855965 TTTGGGATGTTGAAGCAGGCAGG + Intronic
1131832341 15:96361693-96361715 TTTGGGATTTGCCAGATGGCAGG - Intergenic
1132039768 15:98515349-98515371 TGTGGGAGTTTTCAGCATGCAGG - Intergenic
1132204952 15:99980076-99980098 TTTGGGAGGCTGCAGTGGGCAGG + Intronic
1132298036 15:100758398-100758420 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1132415758 15:101617704-101617726 CAGGGGTGTTTGCAGCTGGCGGG + Intergenic
1133761753 16:8804282-8804304 TTTGGGAGGCTGAGGCTGGCGGG - Intronic
1134673798 16:16075326-16075348 TTTAGAAGTGTGGAGCTGGCCGG + Intronic
1135077086 16:19403021-19403043 TTTGTGACTTTGCAGCTGGGAGG - Intergenic
1135734208 16:24917825-24917847 TTTTGAAGTTTGCAGCTGTCAGG + Intergenic
1136860019 16:33693455-33693477 TTTGGGAGACTGCAGGTGGGCGG + Intergenic
1136936796 16:34475846-34475868 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1136947876 16:34677235-34677257 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136955266 16:34777119-34777141 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136958998 16:34823620-34823642 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136963023 16:34872724-34872746 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1136967120 16:34926928-34926950 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1137092172 16:36207199-36207221 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1137221664 16:46458408-46458430 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1137736896 16:50731490-50731512 TTGGGGAGTCTGTGGCTGGCTGG + Intronic
1139635225 16:68254579-68254601 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
1140857982 16:78994596-78994618 TTTGGGAGTTTGCGCCTGCAAGG - Intronic
1141641361 16:85343504-85343526 TTTGGGAGGTTGAAGCAGGAAGG + Intergenic
1203121523 16_KI270728v1_random:1541622-1541644 TTTGGGAGACTGCAGGTGGGCGG + Intergenic
1142654141 17:1379240-1379262 TTTGGGAGGATGAAGCGGGCAGG + Intronic
1142744717 17:1950130-1950152 TTTGGGAGGTTGCATTTGGAGGG + Intronic
1142791653 17:2271331-2271353 TTTGGGAGTCTGAGGCAGGCAGG - Intronic
1144521830 17:15957839-15957861 TTGGGAAGTCTGCAGGTGGCGGG - Intronic
1144573967 17:16417474-16417496 TTTGGGAGGCTGAGGCTGGCTGG - Intronic
1145100125 17:20068201-20068223 TTTGGGAGGCTGAAGCAGGCAGG - Intronic
1145778344 17:27545008-27545030 TCTGGGAGATAGCAGCTGCCAGG + Intronic
1148074341 17:44926960-44926982 TTTGGGAGGTGTCAGCTGTCTGG - Intronic
1149056807 17:52376401-52376423 TCTGTGAGTTGGAAGCTGGCTGG + Intergenic
1150264513 17:63823749-63823771 TTTGGGTGTTTGGAGGTGGGGGG - Intronic
1151139153 17:71975356-71975378 TTTGGGAGGGTCCAGCTGGCCGG + Intergenic
1153475440 18:5494192-5494214 TTGGGGGGTTGGCAGCAGGCAGG - Intronic
1154133055 18:11752241-11752263 GTTGGGAGTTTGCGGTGGGCAGG + Intronic
1155371849 18:25110355-25110377 TTTGGGATTTTGGATCAGGCAGG - Intronic
1157442775 18:47723130-47723152 TTGAGGAGTCTGCAGGTGGCTGG - Intergenic
1157931895 18:51832582-51832604 TATGGAAGTATGCAGCTAGCAGG + Intergenic
1157998968 18:52594030-52594052 ATAGGGAGTAGGCAGCTGGCTGG + Intronic
1158068439 18:53441391-53441413 TTTGGGAGTTGGCACATGGATGG - Intronic
1158265286 18:55654538-55654560 TTTCGAAGTTTTCAGCAGGCAGG + Intronic
1161084349 19:2327642-2327664 TTTGGGAGTCTGAAGCAGGAGGG - Intronic
1161261164 19:3338626-3338648 TTTGGGAGCTTGCAGCCATCAGG - Intergenic
1161428203 19:4216124-4216146 TGGGGGAGTTTGAAGCTGGGAGG + Intronic
1161451273 19:4346786-4346808 TTTGGGAGGCTGAAGCAGGCAGG + Intronic
1162719509 19:12653959-12653981 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
1162932525 19:13964069-13964091 TTAGGGAGGTTGCAGCGGGGTGG - Intronic
1163038706 19:14587133-14587155 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
1163039454 19:14591798-14591820 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
1163482749 19:17567694-17567716 TTTGGGAGACTGCGGCAGGCGGG + Intronic
1163531845 19:17854606-17854628 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1163693309 19:18749408-18749430 TTTGGGAGGTTTCAGCAGGAGGG + Intronic
1163767614 19:19172159-19172181 TTGGGGAGTGTGGAGGTGGCTGG + Intronic
1164178879 19:22802329-22802351 TTTGGTAGTTAGCAGCTGCAGGG + Intergenic
1164228908 19:23270655-23270677 TTTGGGAGGTTGGAGGTGGACGG - Intergenic
1164438897 19:28256596-28256618 GTGGGGAGTTTCCAGGTGGCTGG - Intergenic
1164978507 19:32593940-32593962 TTTGGGAGGCTGAGGCTGGCAGG + Intergenic
1164991090 19:32684597-32684619 TTTGGGAGGCTGAAGCAGGCAGG - Intergenic
1164993365 19:32700670-32700692 TTTGGGAGGCTGAAGCTGGACGG - Intronic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1166148815 19:40855953-40855975 TCTGGTAGTGTGTAGCTGGCCGG - Intronic
1166405035 19:42514371-42514393 TTTGGGAGGTTGAGGCAGGCGGG - Intronic
1166775689 19:45311158-45311180 TTTGGGAGGCTGCAGCAGGAGGG - Intronic
1167840837 19:52118185-52118207 TTTGGGAGGCTGCAGCAGGCAGG - Intronic
1167906944 19:52668940-52668962 GTTGGGAGTTGGAAGCTGGATGG - Intronic
1168398394 19:56067801-56067823 TTTGGGAGGCTGCAGCAGGCAGG + Intergenic
925784501 2:7418006-7418028 TGTGAAAGATTGCAGCTGGCTGG + Intergenic
926246025 2:11122926-11122948 TGGAGGAGTTTGCAGGTGGCTGG - Intergenic
926250460 2:11152935-11152957 TTTGCTAGTTTGCACCTGGTGGG + Intergenic
927021749 2:19024460-19024482 TTTGGGAGAATGCAGTGGGCAGG - Intergenic
927890895 2:26748253-26748275 TTTGGGAGGTTGAGGCAGGCAGG + Intergenic
928438876 2:31274865-31274887 TGTAGGGGTTTGCAGATGGCAGG - Intergenic
929914151 2:46119957-46119979 CCTGGGAGTTTGTAGCTGGGAGG + Intronic
930100506 2:47599520-47599542 TCTAGGATTTTGCAGCTGGCAGG + Intergenic
930272185 2:49269961-49269983 TTTAGCAGTTTGCATATGGCAGG + Intergenic
930513841 2:52380718-52380740 TTTGGGAGTTTGCAGTTTCCTGG + Intergenic
932145042 2:69308870-69308892 TTCTGGAGCTTGCAGCTGGGAGG + Intergenic
932250143 2:70236439-70236461 TTTGGGAGGCTGAAGCAGGCGGG - Intronic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
933759957 2:85666302-85666324 TGTGTGTGTTTCCAGCTGGCTGG + Intronic
934502046 2:94869526-94869548 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
934950393 2:98571702-98571724 TTTGGGGGTATTCAGCTGGTGGG - Intronic
935076320 2:99748087-99748109 CCTGGGGTTTTGCAGCTGGCTGG - Intronic
937306784 2:120876619-120876641 TGCAGGGGTTTGCAGCTGGCAGG + Intronic
937503567 2:122510913-122510935 TTTGGGAGGTCGAAGCAGGCAGG - Intergenic
937839980 2:126515111-126515133 TTTTGGAATTTGTAGCTGGTGGG - Intergenic
937879702 2:126856286-126856308 TTTGGGAAGCTGCAGGTGGCTGG + Intergenic
939378341 2:141400059-141400081 TCTGGGAGATTGAAGCTGCCGGG - Intronic
940904554 2:159157310-159157332 TTGGTTAGTTTGCAGGTGGCCGG + Intronic
943574510 2:189615319-189615341 TTTGGGAGGCTGAAGCTGGCTGG + Intergenic
943691759 2:190876540-190876562 TTTGAGAGTTTCCTGATGGCCGG - Intergenic
944383189 2:199135561-199135583 TTTGGGAGGTTGAGGCAGGCAGG - Intergenic
944786778 2:203079322-203079344 TTTGGGAGTCTGAAGTGGGCAGG - Intronic
948092241 2:235303942-235303964 TTTGGGTGTCTGGAGCAGGCTGG - Intergenic
948131795 2:235606394-235606416 TTTGGGGGTTTGGGGATGGCAGG + Intronic
948277095 2:236717207-236717229 CTTGGGACTTAGCAGATGGCGGG - Intergenic
948413383 2:237782382-237782404 TTTGAAAATTTGCAACTGGCTGG - Intronic
948572015 2:238923606-238923628 GTTGGGAGTCTGCAGGTGGCGGG - Intergenic
948899727 2:240950189-240950211 GTGGGGGGTGTGCAGCTGGCTGG + Intronic
1169870712 20:10245304-10245326 TTAGGGAGGTTGGAGCTGGCAGG + Intronic
1170402665 20:16004660-16004682 TGTGGGAGTTGGCTGCTGACAGG - Intronic
1170722951 20:18900363-18900385 TTTGGAAGTCTCCAGCTCGCTGG - Intergenic
1171148096 20:22803290-22803312 TCTGGTGGTTTGCAGATGGCAGG - Intergenic
1172088430 20:32408173-32408195 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
1172864306 20:38083897-38083919 TATGGGAGCGTGGAGCTGGCTGG + Intronic
1173777930 20:45726826-45726848 TTTAGGGTCTTGCAGCTGGCTGG - Intergenic
1174797932 20:53538082-53538104 TTTGGGAGGTTGGAGGTGGGCGG + Intergenic
1175078393 20:56395506-56395528 TTTCCGTTTTTGCAGCTGGCAGG + Exonic
1176584702 21:8570013-8570035 TTTGGAAAGTTGCAGCTGGGAGG + Intergenic
1176623965 21:9075636-9075658 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1177802740 21:25843918-25843940 TTTGGGAGCTTACAGCTGAACGG + Intergenic
1178535611 21:33407863-33407885 TTTGGGAGGCTGAGGCTGGCGGG - Intronic
1179162590 21:38910337-38910359 TCTGGAAGTCTGCAGCTGCCTGG - Intergenic
1180262877 21:46686736-46686758 ATTGGGCGGTTGCATCTGGCGGG + Intergenic
1180267513 22:10546915-10546937 TTTGGAAAGTTGCAGCTGGGAGG + Intergenic
1180431543 22:15255864-15255886 TCTGGAAGTTTGCAGCGGGGAGG + Intergenic
1180595738 22:16972065-16972087 TTTTGGAGTTTTCAGCTCTCTGG + Intronic
1181065629 22:20304468-20304490 TTTGGGAGGCTGCGGCGGGCAGG - Intergenic
1181180462 22:21064389-21064411 TTTGGGAGGCTGAAGCAGGCAGG + Intergenic
1181886681 22:26027241-26027263 CTTGGGAGTTTCCAGCTGAATGG - Exonic
1182402550 22:30091506-30091528 TTTGGGAGGTTGAGGCAGGCAGG - Intronic
1183860783 22:40668402-40668424 TTTAGAAGTGTGTAGCTGGCCGG + Intergenic
1185005248 22:48272226-48272248 TATTGGAGTCTGCTGCTGGCAGG + Intergenic
1185120769 22:48968630-48968652 TTTGGGAATGTCCAGGTGGCAGG - Intergenic
1185312116 22:50161956-50161978 TCTGGGAGTTTGCAGCTGGGCGG + Intergenic
1203325745 22_KI270738v1_random:14730-14752 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
950555238 3:13691678-13691700 TTTGGGAGGCTGAAGCAGGCGGG - Intergenic
953865861 3:46582836-46582858 TTTGGCAGTTTGCATCTGCAGGG - Intronic
954698401 3:52439555-52439577 TTACTGAATTTGCAGCTGGCAGG - Intronic
954864781 3:53719006-53719028 TTTGGGCTGTGGCAGCTGGCGGG + Intronic
954952972 3:54491239-54491261 TTAGGGAGTTTGCAGCCAGTTGG + Intronic
955005734 3:54966574-54966596 TTTGGGAGGTTGAGGCAGGCAGG + Intronic
958134573 3:89471604-89471626 TTTGGGAGGTTGAGGCCGGCGGG - Intronic
959484160 3:106908508-106908530 TTTGGGAGGCTGCAGCTGGCTGG - Intergenic
960664472 3:120095546-120095568 TCTGAGAGCTTGCAGCCGGCTGG - Intergenic
961278990 3:125750468-125750490 TTTGGGAGGCCGAAGCTGGCAGG - Intergenic
962964560 3:140341574-140341596 CTGGGGTGTTTGCAGGTGGCTGG - Intronic
963094747 3:141524180-141524202 TCTGGGAGATTGGGGCTGGCTGG + Intronic
963288639 3:143463970-143463992 TGTGGTAGTTTGCAGCTGGATGG + Intronic
964750503 3:160049804-160049826 TCTGAGAGTTTCCAGGTGGCTGG + Intergenic
966039964 3:175471241-175471263 TTTGGGAGGCTGAGGCTGGCAGG + Intronic
966855206 3:184189084-184189106 TTAGGGAGTTCTCAGGTGGCTGG + Exonic
967290340 3:187913690-187913712 GAGGGGAGTGTGCAGCTGGCTGG - Intergenic
967734921 3:192941948-192941970 TATGGGAGTTTGGAGTTGGAGGG + Intergenic
968140044 3:196248612-196248634 TTTGGGAGGCTGAGGCTGGCGGG - Intronic
969553770 4:7892288-7892310 TGGGGCAGTTGGCAGCTGGCCGG - Intronic
970320726 4:14873046-14873068 TATGGTAGTTTGCTGGTGGCTGG + Intergenic
972442905 4:39114216-39114238 ATTGGGAGGCTGCATCTGGCAGG + Intronic
973631576 4:52825282-52825304 TAGGAGACTTTGCAGCTGGCTGG - Intergenic
974875560 4:67699844-67699866 TTTGGGAGGTCGAAGCAGGCGGG - Intronic
975534316 4:75433511-75433533 TTTGGGAGGCTGAGGCTGGCAGG - Intergenic
975580717 4:75904911-75904933 TTTGGGAGGCTGAGGCTGGCGGG - Intergenic
975723247 4:77268362-77268384 TCTGGGAGTGTGCAGCTGAAGGG + Intronic
977253887 4:94718924-94718946 TTTGGGAGGTTGAGGCAGGCAGG - Intergenic
977979471 4:103305907-103305929 TTAGGGAGACTGCAGCTTGCTGG + Intergenic
978314283 4:107418397-107418419 TTTGGGAGGTGGAAGCTGGAGGG - Intergenic
979824082 4:125211247-125211269 TTTGGGAGGCTGAAGCAGGCAGG - Intergenic
981331337 4:143513739-143513761 TTTGGGAGTGTGCAGCTCCTGGG + Exonic
984323961 4:178228002-178228024 TTTGGGAGGCTGAAGCGGGCAGG + Intergenic
984399317 4:179241336-179241358 TTTGGTAGTGTTCAGCTGACTGG - Intergenic
984701418 4:182820914-182820936 TTTGGGAGGCTGAGGCTGGCTGG + Intergenic
985492806 5:189203-189225 CATGGGGGTCTGCAGCTGGCAGG - Exonic
985720434 5:1485998-1486020 TCTGAGAGCTTGGAGCTGGCAGG + Intronic
985838901 5:2291086-2291108 TTTGGGAGCTGGGAGCTGGGCGG - Intergenic
987550212 5:19369742-19369764 TTTGGGAGGCTGAGGCTGGCAGG + Intergenic
988124877 5:27017785-27017807 CTTGGGAGGTAGAAGCTGGCAGG + Intronic
991585250 5:68195452-68195474 TTTTGGTGTTTGCAGCTCGAAGG + Intronic
992335068 5:75758810-75758832 TTTGGGAGGCTGAAGCTGGCGGG + Intergenic
992419703 5:76590842-76590864 TTTGGGAGGCTGCAGCGGGAGGG + Intronic
992771076 5:80049026-80049048 TTTGTGAGTTTGCTGCCTGCAGG + Intronic
995431861 5:112088318-112088340 TTTGGGAGGCTGAAGCAGGCAGG + Intergenic
997459550 5:134042727-134042749 TTTGGGAGGCTGAAGCAGGCGGG - Intergenic
997783043 5:136679090-136679112 TTTGGGGGTTTGCATTTGGGTGG - Intergenic
1000642969 5:163726628-163726650 TTTGGGAGTTTGCAGAAGTGTGG + Intergenic
1000806348 5:165797872-165797894 TTTGGGAGGCTGAGGCTGGCAGG - Intergenic
1001572680 5:172740875-172740897 TTTGGGAGCTGGCAGCAGCCTGG - Intergenic
1003005453 6:2376930-2376952 TTTAGAAGTTTGCAGCAGTCCGG + Intergenic
1004479727 6:16007080-16007102 TTCTGGAGCTTGAAGCTGGCTGG - Intergenic
1005461995 6:26078087-26078109 TTTGGGAGATGGAAGCTGGATGG - Intergenic
1005718444 6:28576504-28576526 TTTGGGAGGCTGAGGCTGGCAGG - Intronic
1006147755 6:31969435-31969457 TTTGGGATTTTGCAGACGGCTGG + Intronic
1006793447 6:36717963-36717985 TCTGGGAGCCTGCTGCTGGCAGG - Intronic
1007971046 6:46052688-46052710 TGTGGGAGTTGGCTGCTGTCTGG - Intronic
1008512186 6:52286743-52286765 TTGGGCAGTTTGCAGGTGTCGGG - Intergenic
1008954835 6:57203246-57203268 TTTGGGAGGCTGCGGCCGGCAGG - Intronic
1015549416 6:134396672-134396694 TTTGGGAGTCTGAGGCGGGCGGG - Intergenic
1016190393 6:141258654-141258676 TTTGGTAGTTTGCATCTTTCTGG - Intergenic
1017793333 6:157820915-157820937 TTTGGGAGGCTGCGGCGGGCGGG - Intronic
1018571145 6:165211295-165211317 TTTGCGAGTGGGCAGCTTGCTGG - Intergenic
1019920647 7:4161291-4161313 CTGGTGAGGTTGCAGCTGGCTGG - Intronic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1021122643 7:16814593-16814615 TTTTTGAGTTTGCATCTGGCAGG + Intronic
1021908656 7:25362273-25362295 TTTGTGAGGTTGCAGCAGGAAGG - Intergenic
1022028446 7:26469659-26469681 TTTGGGAGGTTGAAGCAGGTGGG + Intergenic
1025305947 7:57855505-57855527 TTTGGAATGTTGCAGCAGGCAGG - Intergenic
1025483246 7:61012900-61012922 TTTGGAATATTGCAGCTGGGAGG + Intergenic
1025554301 7:62285310-62285332 TTTGGAATGTTGCAGCTGGGAGG - Intergenic
1025560480 7:62367964-62367986 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1025564560 7:62417268-62417290 TTTGGAATGTTGCAGCTGGGAGG + Intergenic
1026027890 7:66761806-66761828 TTTGGGAGTTTGAGGTAGGCAGG + Intronic
1027221124 7:76214560-76214582 GCTGGGAGTGTGCAGGTGGCAGG + Intronic
1027284484 7:76634149-76634171 TTTGGGAGTCTGCGGGTGGGTGG - Intergenic
1029564400 7:101326066-101326088 TTTGGGAGGCTGAGGCTGGCGGG + Intergenic
1032326336 7:130932345-130932367 TTTGGGAGGTTGAGGCGGGCAGG + Intergenic
1032624880 7:133581184-133581206 TATGGAAGTTTGAAGTTGGCTGG + Intronic
1033111800 7:138585965-138585987 TTTGGGAGCAGGCAGCTGGGGGG + Exonic
1033861605 7:145634915-145634937 TTTGGGAGTCTGAGGCTGACGGG - Intergenic
1034117064 7:148592755-148592777 TTTGGGAGGTTGAGGCAGGCAGG - Intronic
1034465418 7:151225673-151225695 TTAGGGAGTTTTCAGGGGGCAGG + Intronic
1034557108 7:151857268-151857290 TCTGGGAGCTGGGAGCTGGCAGG - Intronic
1035496310 7:159329961-159329983 TTTGAGAGTGTGAAGCTGTCAGG - Intergenic
1036463577 8:8975216-8975238 TTTGGGAGGCTGAAGCTGGCAGG + Intergenic
1038020273 8:23546971-23546993 TCTGGGAGTTGGGAGCAGGCTGG + Intronic
1039898646 8:41734647-41734669 TTTGGGAGGCTGAAGCAGGCTGG + Intronic
1040566733 8:48574000-48574022 TTTGGGGGTTTGTAGCTTGATGG + Intergenic
1044982045 8:97726776-97726798 TTTAAGAGATGGCAGCTGGCCGG + Exonic
1045107514 8:98907269-98907291 TTTGGGAGGCTGAGGCTGGCGGG + Intronic
1045281926 8:100756903-100756925 TTTGAGAATCTGCATCTGGCTGG + Intergenic
1045747116 8:105436275-105436297 TTTGGGAGGCTGAAGCAGGCTGG + Intronic
1049310288 8:141930565-141930587 TTTGTGATTGTGCAGCTGGAGGG + Intergenic
1049622635 8:143605533-143605555 CTTGGGAGGTTCCAGCAGGCGGG - Exonic
1049638134 8:143700346-143700368 TGTGGGGGTCTGCAGCTGGATGG - Intronic
1049783296 8:144438794-144438816 TTGGGGAGCTTGCAGCAGGGTGG - Intronic
1051527596 9:18064167-18064189 CCTGGGAGTGTGCAGCTGGATGG + Intergenic
1052348000 9:27429291-27429313 TGTGGGGCTATGCAGCTGGCTGG - Intronic
1052922261 9:33980711-33980733 TTTGGGAGTTTGAGGTGGGCGGG + Intronic
1052973485 9:34395207-34395229 TTTGGGAGGTTGAAGCAGACAGG - Intronic
1054771279 9:69086478-69086500 CTTGGGAGTTTGCAGCAGGGAGG + Intronic
1054947594 9:70812272-70812294 TTTGGCAGCTGGTAGCTGGCTGG + Intronic
1055123825 9:72695406-72695428 TTTGGAAATTTGCAGATAGCAGG + Intronic
1057046998 9:91893620-91893642 TTTGGGAGTTTGCATCTCAGAGG + Intronic
1058510633 9:105713270-105713292 TTTGGGGGGCTGCAGCTGTCGGG - Intronic
1059144614 9:111887274-111887296 TTTGGGAGGCTGAATCTGGCAGG - Intergenic
1059943914 9:119386383-119386405 TTTGGGAGGCTGAAGCTGGCGGG - Intergenic
1060294634 9:122334935-122334957 TTTGGGATTTTTAAGCTGCCGGG + Intergenic
1061605226 9:131705107-131705129 TTTGGGACTTGGAAGGTGGCAGG - Intronic
1203747148 Un_GL000218v1:46064-46086 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1203562958 Un_KI270744v1:73416-73438 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
1186779543 X:12899078-12899100 TTTGGGATTTTAAAGCTGGAGGG + Intergenic
1189656047 X:43246088-43246110 TTTGGGAGGCTGAAGCAGGCGGG - Intergenic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1190023452 X:46900416-46900438 TTTGGGAGGCTGAAGCGGGCGGG + Intergenic
1191837196 X:65477074-65477096 TTTGGGAGTCTGAAGCTGGCAGG - Intronic
1194046144 X:89005917-89005939 TTTGGGAATTTCCAGCAGTCTGG - Intergenic
1194257678 X:91654114-91654136 TGTAGGAGTTTGAAGCTGGTGGG - Intergenic
1194282405 X:91969554-91969576 TTTGGGAGTCTGAAGGTGGGAGG + Intronic
1200576335 Y:4893060-4893082 TGTAGGAGTTTGAAGCTGGTGGG - Intergenic
1200599994 Y:5194191-5194213 TTTGGGAGTCTGAAGGTGGGAGG + Intronic
1201160469 Y:11161059-11161081 TTTGGGATTTTGCAGCTGGCAGG - Intergenic
1201221843 Y:11779079-11779101 TTTGGGAGTATGCAGTAGGGTGG + Intergenic