ID: 1202919016 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_KI270723v1_random:13638-13660 |
| Sequence | TTCCTGTGGGCAGGCTAAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202919011_1202919016 | -2 | Left | 1202919011 | 14_KI270723v1_random:13617-13639 | CCATGCTATATAGAACAATGCTT | No data | ||
| Right | 1202919016 | 14_KI270723v1_random:13638-13660 | TTCCTGTGGGCAGGCTAAGGTGG | No data | ||||
| 1202919009_1202919016 | 11 | Left | 1202919009 | 14_KI270723v1_random:13604-13626 | CCTGGGTGCCAGGCCATGCTATA | No data | ||
| Right | 1202919016 | 14_KI270723v1_random:13638-13660 | TTCCTGTGGGCAGGCTAAGGTGG | No data | ||||
| 1202919010_1202919016 | 3 | Left | 1202919010 | 14_KI270723v1_random:13612-13634 | CCAGGCCATGCTATATAGAACAA | No data | ||
| Right | 1202919016 | 14_KI270723v1_random:13638-13660 | TTCCTGTGGGCAGGCTAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202919016 | Original CRISPR | TTCCTGTGGGCAGGCTAAGG TGG | Intergenic | ||