ID: 1202919016

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270723v1_random:13638-13660
Sequence TTCCTGTGGGCAGGCTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202919011_1202919016 -2 Left 1202919011 14_KI270723v1_random:13617-13639 CCATGCTATATAGAACAATGCTT No data
Right 1202919016 14_KI270723v1_random:13638-13660 TTCCTGTGGGCAGGCTAAGGTGG No data
1202919009_1202919016 11 Left 1202919009 14_KI270723v1_random:13604-13626 CCTGGGTGCCAGGCCATGCTATA No data
Right 1202919016 14_KI270723v1_random:13638-13660 TTCCTGTGGGCAGGCTAAGGTGG No data
1202919010_1202919016 3 Left 1202919010 14_KI270723v1_random:13612-13634 CCAGGCCATGCTATATAGAACAA No data
Right 1202919016 14_KI270723v1_random:13638-13660 TTCCTGTGGGCAGGCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202919016 Original CRISPR TTCCTGTGGGCAGGCTAAGG TGG Intergenic