ID: 1202920398 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_KI270723v1_random:25974-25996 |
| Sequence | TCTTGGGTGGACAGGCAAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202920392_1202920398 | 5 | Left | 1202920392 | 14_KI270723v1_random:25946-25968 | CCAGCTTTGTTGTTTTTGCTTAG | 0: 89 1: 4546 2: 15574 3: 6936 4: 3933 |
||
| Right | 1202920398 | 14_KI270723v1_random:25974-25996 | TCTTGGGTGGACAGGCAAACAGG | No data | ||||
| 1202920391_1202920398 | 8 | Left | 1202920391 | 14_KI270723v1_random:25943-25965 | CCTCCAGCTTTGTTGTTTTTGCT | 0: 108 1: 4618 2: 15828 3: 7273 4: 5106 |
||
| Right | 1202920398 | 14_KI270723v1_random:25974-25996 | TCTTGGGTGGACAGGCAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202920398 | Original CRISPR | TCTTGGGTGGACAGGCAAAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||