ID: 1202920398

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270723v1_random:25974-25996
Sequence TCTTGGGTGGACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202920392_1202920398 5 Left 1202920392 14_KI270723v1_random:25946-25968 CCAGCTTTGTTGTTTTTGCTTAG 0: 89
1: 4546
2: 15574
3: 6936
4: 3933
Right 1202920398 14_KI270723v1_random:25974-25996 TCTTGGGTGGACAGGCAAACAGG No data
1202920391_1202920398 8 Left 1202920391 14_KI270723v1_random:25943-25965 CCTCCAGCTTTGTTGTTTTTGCT 0: 108
1: 4618
2: 15828
3: 7273
4: 5106
Right 1202920398 14_KI270723v1_random:25974-25996 TCTTGGGTGGACAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202920398 Original CRISPR TCTTGGGTGGACAGGCAAAC AGG Intergenic
No off target data available for this crispr