ID: 1202920792

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270723v1_random:29127-29149
Sequence CAGAGAGTAGGGAAGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202920787_1202920792 -10 Left 1202920787 14_KI270723v1_random:29114-29136 CCCATCTGGGCTGCAGAGAGTAG No data
Right 1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG No data
1202920786_1202920792 -1 Left 1202920786 14_KI270723v1_random:29105-29127 CCAAGTTTTCCCATCTGGGCTGC No data
Right 1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG No data
1202920785_1202920792 2 Left 1202920785 14_KI270723v1_random:29102-29124 CCTCCAAGTTTTCCCATCTGGGC No data
Right 1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202920792 Original CRISPR CAGAGAGTAGGGAAGGAAGT CGG Intergenic
No off target data available for this crispr