ID: 1202921967

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270723v1_random:35273-35295
Sequence GGCTCATGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202921967_1202921976 16 Left 1202921967 14_KI270723v1_random:35273-35295 CCCACAGGGGGCTTTCATGAGCC No data
Right 1202921976 14_KI270723v1_random:35312-35334 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786
1202921967_1202921980 25 Left 1202921967 14_KI270723v1_random:35273-35295 CCCACAGGGGGCTTTCATGAGCC No data
Right 1202921980 14_KI270723v1_random:35321-35343 CCAGCCCAGCCAGGCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202921967 Original CRISPR GGCTCATGAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr