ID: 1202921980

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270723v1_random:35321-35343
Sequence CCAGCCCAGCCAGGCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202921967_1202921980 25 Left 1202921967 14_KI270723v1_random:35273-35295 CCCACAGGGGGCTTTCATGAGCC No data
Right 1202921980 14_KI270723v1_random:35321-35343 CCAGCCCAGCCAGGCCGCGCCGG No data
1202921973_1202921980 4 Left 1202921973 14_KI270723v1_random:35294-35316 CCAGGGAGCGAGGGCCGTCCCCG 0: 5
1: 4
2: 32
3: 20
4: 126
Right 1202921980 14_KI270723v1_random:35321-35343 CCAGCCCAGCCAGGCCGCGCCGG No data
1202921968_1202921980 24 Left 1202921968 14_KI270723v1_random:35274-35296 CCACAGGGGGCTTTCATGAGCCA No data
Right 1202921980 14_KI270723v1_random:35321-35343 CCAGCCCAGCCAGGCCGCGCCGG No data
1202921974_1202921980 -10 Left 1202921974 14_KI270723v1_random:35308-35330 CCGTCCCCGTGCTCCAGCCCAGC 0: 10
1: 10
2: 13
3: 69
4: 604
Right 1202921980 14_KI270723v1_random:35321-35343 CCAGCCCAGCCAGGCCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202921980 Original CRISPR CCAGCCCAGCCAGGCCGCGC CGG Intergenic
No off target data available for this crispr