ID: 1202924124

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270724v1_random:8454-8476
Sequence CAGAGAGTAGGGAAGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202924124_1202924130 -1 Left 1202924124 14_KI270724v1_random:8454-8476 CCGACTTCCTTCCCTACTCTCTG No data
Right 1202924130 14_KI270724v1_random:8476-8498 GCAGCCCAGATGGGAAAACTTGG No data
1202924124_1202924131 2 Left 1202924124 14_KI270724v1_random:8454-8476 CCGACTTCCTTCCCTACTCTCTG No data
Right 1202924131 14_KI270724v1_random:8479-8501 GCCCAGATGGGAAAACTTGGAGG No data
1202924124_1202924129 -10 Left 1202924124 14_KI270724v1_random:8454-8476 CCGACTTCCTTCCCTACTCTCTG No data
Right 1202924129 14_KI270724v1_random:8467-8489 CTACTCTCTGCAGCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202924124 Original CRISPR CAGAGAGTAGGGAAGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr