ID: 1202925613

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270724v1_random:21357-21379
Sequence TTCCTGTGGGCAGGCTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202925613_1202925618 -2 Left 1202925613 14_KI270724v1_random:21357-21379 CCACCTTAGCCTGCCCACAGGAA No data
Right 1202925618 14_KI270724v1_random:21378-21400 AAGCATTGTTCTATATAGCATGG No data
1202925613_1202925619 3 Left 1202925613 14_KI270724v1_random:21357-21379 CCACCTTAGCCTGCCCACAGGAA No data
Right 1202925619 14_KI270724v1_random:21383-21405 TTGTTCTATATAGCATGGCCTGG No data
1202925613_1202925620 11 Left 1202925613 14_KI270724v1_random:21357-21379 CCACCTTAGCCTGCCCACAGGAA No data
Right 1202925620 14_KI270724v1_random:21391-21413 TATAGCATGGCCTGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202925613 Original CRISPR TTCCTGTGGGCAGGCTAAGG TGG (reversed) Intergenic