ID: 1202926218

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270724v1_random:28416-28438
Sequence GGTCAGCTCGGGCTCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202926203_1202926218 27 Left 1202926203 14_KI270724v1_random:28366-28388 CCTGCAGCTCAGCGTTCGGGTTC No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data
1202926209_1202926218 -8 Left 1202926209 14_KI270724v1_random:28401-28423 CCTCCTTCTCCGCTGGGTCAGCT No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data
1202926201_1202926218 30 Left 1202926201 14_KI270724v1_random:28363-28385 CCGCCTGCAGCTCAGCGTTCGGG No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data
1202926204_1202926218 5 Left 1202926204 14_KI270724v1_random:28388-28410 CCAGCTTCTCCGCCCTCCTTCTC No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data
1202926208_1202926218 -7 Left 1202926208 14_KI270724v1_random:28400-28422 CCCTCCTTCTCCGCTGGGTCAGC No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data
1202926207_1202926218 -4 Left 1202926207 14_KI270724v1_random:28397-28419 CCGCCCTCCTTCTCCGCTGGGTC No data
Right 1202926218 14_KI270724v1_random:28416-28438 GGTCAGCTCGGGCTCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202926218 Original CRISPR GGTCAGCTCGGGCTCGGGGA GGG Intergenic
No off target data available for this crispr