ID: 1202930737

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270725v1_random:30711-30733
Sequence CTCTGGCCCTGCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202930737_1202930743 -2 Left 1202930737 14_KI270725v1_random:30711-30733 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1202930743 14_KI270725v1_random:30732-30754 AGCTGGAATTGGAGGTGTCCTGG No data
1202930737_1202930741 -10 Left 1202930737 14_KI270725v1_random:30711-30733 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1202930741 14_KI270725v1_random:30724-30746 AGGGCCAGAGCTGGAATTGGAGG No data
1202930737_1202930745 24 Left 1202930737 14_KI270725v1_random:30711-30733 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202930737 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr