ID: 1202930739

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270725v1_random:30717-30739
Sequence TTCCAGCTCTGGCCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202930739_1202930745 18 Left 1202930739 14_KI270725v1_random:30717-30739 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data
1202930739_1202930743 -8 Left 1202930739 14_KI270725v1_random:30717-30739 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1202930743 14_KI270725v1_random:30732-30754 AGCTGGAATTGGAGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202930739 Original CRISPR TTCCAGCTCTGGCCCTGCCT TGG (reversed) Intergenic
No off target data available for this crispr