ID: 1202930742

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270725v1_random:30728-30750
Sequence GACACCTCCAATTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202930742_1202930745 7 Left 1202930742 14_KI270725v1_random:30728-30750 CCAGAGCTGGAATTGGAGGTGTC No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data
1202930742_1202930751 23 Left 1202930742 14_KI270725v1_random:30728-30750 CCAGAGCTGGAATTGGAGGTGTC No data
Right 1202930751 14_KI270725v1_random:30774-30796 ACGTTGGCCCAGCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202930742 Original CRISPR GACACCTCCAATTCCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr