ID: 1202930745

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270725v1_random:30758-30780
Sequence GATTTGCCCTGCCCCGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202930742_1202930745 7 Left 1202930742 14_KI270725v1_random:30728-30750 CCAGAGCTGGAATTGGAGGTGTC No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data
1202930739_1202930745 18 Left 1202930739 14_KI270725v1_random:30717-30739 CCAAGGCAGGGCCAGAGCTGGAA No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data
1202930737_1202930745 24 Left 1202930737 14_KI270725v1_random:30711-30733 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 1202930745 14_KI270725v1_random:30758-30780 GATTTGCCCTGCCCCGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202930745 Original CRISPR GATTTGCCCTGCCCCGACGT TGG Intergenic
No off target data available for this crispr