ID: 1202941843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14_KI270725v1_random:156414-156436 |
| Sequence | ACTTATATGCTGACTGTACA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202941842_1202941843 | 3 | Left | 1202941842 | 14_KI270725v1_random:156388-156410 | CCAGATAGGTAATCTTCTGTTAT | No data | ||
| Right | 1202941843 | 14_KI270725v1_random:156414-156436 | ACTTATATGCTGACTGTACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202941843 | Original CRISPR | ACTTATATGCTGACTGTACA CGG | Intergenic | ||
| No off target data available for this crispr | |||||