ID: 1202941843

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270725v1_random:156414-156436
Sequence ACTTATATGCTGACTGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202941842_1202941843 3 Left 1202941842 14_KI270725v1_random:156388-156410 CCAGATAGGTAATCTTCTGTTAT No data
Right 1202941843 14_KI270725v1_random:156414-156436 ACTTATATGCTGACTGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202941843 Original CRISPR ACTTATATGCTGACTGTACA CGG Intergenic
No off target data available for this crispr