ID: 1202946003

View in Genome Browser
Species Human (GRCh38)
Location 14_KI270726v1_random:27496-27518
Sequence GATCTGAGCAGAGCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202946003_1202946007 22 Left 1202946003 14_KI270726v1_random:27496-27518 CCAGCAGTGGCTCTGCTCAGATC No data
Right 1202946007 14_KI270726v1_random:27541-27563 TAAGAGTGGAGCACAGGACGTGG No data
1202946003_1202946004 8 Left 1202946003 14_KI270726v1_random:27496-27518 CCAGCAGTGGCTCTGCTCAGATC No data
Right 1202946004 14_KI270726v1_random:27527-27549 GCTTGTTCATCTCCTAAGAGTGG No data
1202946003_1202946005 16 Left 1202946003 14_KI270726v1_random:27496-27518 CCAGCAGTGGCTCTGCTCAGATC No data
Right 1202946005 14_KI270726v1_random:27535-27557 ATCTCCTAAGAGTGGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202946003 Original CRISPR GATCTGAGCAGAGCCACTGC TGG (reversed) Intergenic
No off target data available for this crispr