ID: 1202951977

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:47926-47948
Sequence GAGTCGTGGGAGAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202951977_1202951983 -6 Left 1202951977 15_KI270727v1_random:47926-47948 CCTACCACCTTCTCCCACGACTC No data
Right 1202951983 15_KI270727v1_random:47943-47965 CGACTCCAACATAAGAAAATGGG No data
1202951977_1202951982 -7 Left 1202951977 15_KI270727v1_random:47926-47948 CCTACCACCTTCTCCCACGACTC No data
Right 1202951982 15_KI270727v1_random:47942-47964 ACGACTCCAACATAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202951977 Original CRISPR GAGTCGTGGGAGAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr