ID: 1202953279

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:57981-58003
Sequence GGTGGTGGTTGTTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202953279_1202953286 4 Left 1202953279 15_KI270727v1_random:57981-58003 CCCTTTGCTGAACAACCACCACC No data
Right 1202953286 15_KI270727v1_random:58008-58030 TTCTAGGGCCCCCACACCCTTGG No data
1202953279_1202953289 13 Left 1202953279 15_KI270727v1_random:57981-58003 CCCTTTGCTGAACAACCACCACC No data
Right 1202953289 15_KI270727v1_random:58017-58039 CCCCACACCCTTGGTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202953279 Original CRISPR GGTGGTGGTTGTTCAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr