ID: 1202956901

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:85025-85047
Sequence AGCCCTCCTCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202956894_1202956901 4 Left 1202956894 15_KI270727v1_random:84998-85020 CCTGATATTCTCTGTGATAGAGG No data
Right 1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202956901 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG Intergenic
No off target data available for this crispr