ID: 1202958313

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:96693-96715
Sequence ATTCCAGGCCGCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202958313_1202958319 13 Left 1202958313 15_KI270727v1_random:96693-96715 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1202958319 15_KI270727v1_random:96729-96751 ACCCCCGCCCTGCTGCTCCACGG No data
1202958313_1202958317 -10 Left 1202958313 15_KI270727v1_random:96693-96715 CCCACTCCGCAGCGGCCTGGAAT No data
Right 1202958317 15_KI270727v1_random:96706-96728 GGCCTGGAATATGGCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202958313 Original CRISPR ATTCCAGGCCGCTGCGGAGT GGG (reversed) Intergenic
No off target data available for this crispr