ID: 1202966228

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:178986-179008
Sequence TGAGCTCTGCGTGCGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202966220_1202966228 11 Left 1202966220 15_KI270727v1_random:178952-178974 CCTATGGCTCGCCTCCACCGGCC No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data
1202966222_1202966228 0 Left 1202966222 15_KI270727v1_random:178963-178985 CCTCCACCGGCCGGCACGCAAGG No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data
1202966226_1202966228 -10 Left 1202966226 15_KI270727v1_random:178973-178995 CCGGCACGCAAGGTGAGCTCTGC No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data
1202966224_1202966228 -3 Left 1202966224 15_KI270727v1_random:178966-178988 CCACCGGCCGGCACGCAAGGTGA No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data
1202966218_1202966228 17 Left 1202966218 15_KI270727v1_random:178946-178968 CCGTCACCTATGGCTCGCCTCCA No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data
1202966225_1202966228 -6 Left 1202966225 15_KI270727v1_random:178969-178991 CCGGCCGGCACGCAAGGTGAGCT No data
Right 1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202966228 Original CRISPR TGAGCTCTGCGTGCGCCCGG CGG Intergenic
No off target data available for this crispr