ID: 1202966830

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:183703-183725
Sequence ATGGACAAAAGTGCCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202966830_1202966836 7 Left 1202966830 15_KI270727v1_random:183703-183725 CCCATAAAGGCACTTTTGTCCAT No data
Right 1202966836 15_KI270727v1_random:183733-183755 TGCAAAAGTATTGTAGCTGTGGG No data
1202966830_1202966835 6 Left 1202966830 15_KI270727v1_random:183703-183725 CCCATAAAGGCACTTTTGTCCAT No data
Right 1202966835 15_KI270727v1_random:183732-183754 CTGCAAAAGTATTGTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202966830 Original CRISPR ATGGACAAAAGTGCCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr