ID: 1202966935 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15_KI270727v1_random:185312-185334 |
Sequence | TAGCTAAAGGAATTTGGTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202966935_1202966938 | 8 | Left | 1202966935 | 15_KI270727v1_random:185312-185334 | CCAGCACCAAATTCCTTTAGCTA | No data | ||
Right | 1202966938 | 15_KI270727v1_random:185343-185365 | TCACAATGTATTCCAAAATCAGG | No data | ||||
1202966935_1202966939 | 11 | Left | 1202966935 | 15_KI270727v1_random:185312-185334 | CCAGCACCAAATTCCTTTAGCTA | No data | ||
Right | 1202966939 | 15_KI270727v1_random:185346-185368 | CAATGTATTCCAAAATCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202966935 | Original CRISPR | TAGCTAAAGGAATTTGGTGC TGG (reversed) | Intergenic | ||