ID: 1202966935

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:185312-185334
Sequence TAGCTAAAGGAATTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202966935_1202966939 11 Left 1202966935 15_KI270727v1_random:185312-185334 CCAGCACCAAATTCCTTTAGCTA No data
Right 1202966939 15_KI270727v1_random:185346-185368 CAATGTATTCCAAAATCAGGAGG No data
1202966935_1202966938 8 Left 1202966935 15_KI270727v1_random:185312-185334 CCAGCACCAAATTCCTTTAGCTA No data
Right 1202966938 15_KI270727v1_random:185343-185365 TCACAATGTATTCCAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202966935 Original CRISPR TAGCTAAAGGAATTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr