ID: 1202966939

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:185346-185368
Sequence CAATGTATTCCAAAATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202966935_1202966939 11 Left 1202966935 15_KI270727v1_random:185312-185334 CCAGCACCAAATTCCTTTAGCTA No data
Right 1202966939 15_KI270727v1_random:185346-185368 CAATGTATTCCAAAATCAGGAGG No data
1202966937_1202966939 -2 Left 1202966937 15_KI270727v1_random:185325-185347 CCTTTAGCTACTGTAGCTTCACA No data
Right 1202966939 15_KI270727v1_random:185346-185368 CAATGTATTCCAAAATCAGGAGG No data
1202966936_1202966939 5 Left 1202966936 15_KI270727v1_random:185318-185340 CCAAATTCCTTTAGCTACTGTAG No data
Right 1202966939 15_KI270727v1_random:185346-185368 CAATGTATTCCAAAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202966939 Original CRISPR CAATGTATTCCAAAATCAGG AGG Intergenic
No off target data available for this crispr