ID: 1202971339

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:241585-241607
Sequence CCCATTGCCTTTCTACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202971339_1202971351 16 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971351 15_KI270727v1_random:241624-241646 GGGCTGCCCGCGGCGGGGGCTGG No data
1202971339_1202971346 9 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971346 15_KI270727v1_random:241617-241639 CTATCCAGGGCTGCCCGCGGCGG No data
1202971339_1202971348 11 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971348 15_KI270727v1_random:241619-241641 ATCCAGGGCTGCCCGCGGCGGGG No data
1202971339_1202971344 -4 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971344 15_KI270727v1_random:241604-241626 TGGGGTAGGTAAGCTATCCAGGG No data
1202971339_1202971347 10 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971347 15_KI270727v1_random:241618-241640 TATCCAGGGCTGCCCGCGGCGGG No data
1202971339_1202971352 20 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971352 15_KI270727v1_random:241628-241650 TGCCCGCGGCGGGGGCTGGTTGG No data
1202971339_1202971345 6 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971345 15_KI270727v1_random:241614-241636 AAGCTATCCAGGGCTGCCCGCGG No data
1202971339_1202971355 22 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971355 15_KI270727v1_random:241630-241652 CCCGCGGCGGGGGCTGGTTGGGG No data
1202971339_1202971353 21 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971353 15_KI270727v1_random:241629-241651 GCCCGCGGCGGGGGCTGGTTGGG No data
1202971339_1202971343 -5 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971343 15_KI270727v1_random:241603-241625 ATGGGGTAGGTAAGCTATCCAGG No data
1202971339_1202971349 12 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971349 15_KI270727v1_random:241620-241642 TCCAGGGCTGCCCGCGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202971339 Original CRISPR CCCATTGCCTTTCTACACTC TGG (reversed) Intergenic
No off target data available for this crispr