ID: 1202971347

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:241618-241640
Sequence TATCCAGGGCTGCCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202971339_1202971347 10 Left 1202971339 15_KI270727v1_random:241585-241607 CCAGAGTGTAGAAAGGCAATGGG No data
Right 1202971347 15_KI270727v1_random:241618-241640 TATCCAGGGCTGCCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202971347 Original CRISPR TATCCAGGGCTGCCCGCGGC GGG Intergenic
No off target data available for this crispr