ID: 1202971868

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:243785-243807
Sequence TAGGGTGGGTAGGAAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202971851_1202971868 23 Left 1202971851 15_KI270727v1_random:243739-243761 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG No data
1202971849_1202971868 30 Left 1202971849 15_KI270727v1_random:243732-243754 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG No data
1202971859_1202971868 -7 Left 1202971859 15_KI270727v1_random:243769-243791 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202971868 Original CRISPR TAGGGTGGGTAGGAAGCTTC GGG Intergenic
No off target data available for this crispr