ID: 1202973049

View in Genome Browser
Species Human (GRCh38)
Location 15_KI270727v1_random:259533-259555
Sequence CTCAATCCTGGGACCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202973049_1202973061 29 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973061 15_KI270727v1_random:259585-259607 AAGGGATAAGTAATGAGGAATGG No data
1202973049_1202973057 10 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973057 15_KI270727v1_random:259566-259588 ACAGAGCCTCAGACTCTGGAAGG No data
1202973049_1202973058 11 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973058 15_KI270727v1_random:259567-259589 CAGAGCCTCAGACTCTGGAAGGG No data
1202973049_1202973062 30 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973062 15_KI270727v1_random:259586-259608 AGGGATAAGTAATGAGGAATGGG No data
1202973049_1202973060 24 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973060 15_KI270727v1_random:259580-259602 TCTGGAAGGGATAAGTAATGAGG No data
1202973049_1202973056 6 Left 1202973049 15_KI270727v1_random:259533-259555 CCCCCACTGGTCCCAGGATTGAG No data
Right 1202973056 15_KI270727v1_random:259562-259584 AGAGACAGAGCCTCAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202973049 Original CRISPR CTCAATCCTGGGACCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr